Quickcheck

Question ID Question Stem Text
3 You are trying to remove all bacteria from a solution by filtering it. What is the maximum pore size…
4 He was a Dutch merchant who as a hobby ground glass lenses and would examine various samples. He rep…
5 Of the following pairs, which ones are most closely related. You will need to consult a phylogenetic…
6 If you wanted to examine the structure of an intact flagellum on the surface of a bacterial cell in …
7 A major difference between previous, traditional classification systems and molecular phylogeny is t…
8 Dr. Lynn Margulis proposed that the mitochondria is actually an endosymbiont whose distant ancestor …
10 Microorganisms are important for our health because…
11 Studying microorganisms is worthwhile because…
12 Which general statement is true of “universal” cellular structures found in all three Do…
13 Though prokaryote is not an accurate phylogenetic grouping, Bacteria and Archaea do share certain st…
14 DNA is used in lieu of RNA as the hereditary material because…
16 Which of the follow transport mechanisms cannot concentrate molecules…
17 What are the wavy appendages coming out of the cell shown in the photomicrograph?<br /> <img alt="" …
19 <i>E. coli</i> makes an aquaporin, AqpZ. Deletion of this gene (removal of the activity from the cel…
20 To transport glucose across a membrane a bacterial cell would most often use…
21 The nucleoid is…
22 A bacterial strain has a mutation such that it can only synthesize saturated fatty acids. This mutan…
24 A major difference between Gram-negative and Gram-positive cell wall structure is that…
25 The shape of almost all rod-shaped cells is partially dictated by…
26 Efflux pumps and secretion systems both __________, but are different because secretion systems ____…
27 Which of the follow statements about the cell envelope is false…
28 Major cellular differences between Eukarya and Archaea include...…
29 Major cellular differences between Eukarya and Bacteria are…
30 An individual virus can have a genome composed of…
31 The outcome of viral infection can take several paths for bacteriophage and animal viruses. Of the o…
32 Animal viruses can enter cells in a manner that is unique to animal cells. This method is by…
33 If you compare the Qβ bacteriophage to λ bacteriophage, the major difference between them is…
34 A researcher has found a new primate virus that is devastating the chimpanzee population. As a first…
35 A microbe growing in a lake, using carbon dioxide as its carbon source, hydrogen sulfide as its sour…
36 You create a mutant strain of <i>Bacillus cereus</i> (a facultative anaerobe) such that it has an in…
37 In E. coli if you create a strain that no longer has the MinC protein. This strain would…
38 Which of the following classes of microorganisms have mycelial growth and form spores…
39 The insulin gene, including its promoter and terminator, is cloned from a human pancreas cell into <…
40 About 30% of base pair changes in genes on DNA have no effect on the amino acid translated. This is …
41 The actual translation of the genetic code from nucleic acid to amino acid takes place during…
42 When growing in the environment, microorganisms stick together via an extracellular, polysaccharide …
44 An excellent piece of evidence that chloroplasts in plant cells are ancient symbionts descended from…
46 You have isolated a new protozoan that has an unusual inclusion. You think the inclusion is actually…
47 The metabolic pathway for the synthesis of glycine is 90% similar between <i>E. coli</i> and the pla…
48 One approach to defining species in Bacterial and Archaeal strains is to count any two strains that …
49 Archaea and Bacteria share this trait...…
50 In your research, you are trying to determine the phylogenetic relationship between a group of 15 pr…
51 Of the following pairs, which ones are most distantly related. You will need to consult a phylogenet…
52 Bucky Badger has isolated a new microorganism off of the turf on the marching band field. His candid…
53 One of the major contributors to the foundations of molecular phylogeny and modern phylogenetic clas…
54 A major difference between Gram-negative and Gram-positive cell wall structure is that ...…
58 If an attractant was present, cells do which of the following?…
59 What is the function of the Pribnow box?…
60 Who discovered the vaccine for smallpox?…
61 What is a difference in archaeal cell membranes compared to eukaryotic membranes?…
62 DNA viruses most commonly replicate in the __________, while RNA viruses most commonly replicate in …
63 What do RNA viruses and DNA viruses that infect bacteria have in common?…
64 The common cold is caused by an RNA virus called rhinovirus. Why is it so hard to control the spread…
65 Which of these is false regarding ways in which microorganisms impact our lives?…
66 <table class="table table-striped"> <tbody> <tr> <td>Seq A</td> <td>C</td> <td>C</t…
67 Which statement best describes the relative size of microbes in relation to other organisms?…
68 Here is a set of alignments for 16S rRNA.</p> <p>&nbsp;</p> <table class="table table-striped"…
69 A molecule that contains a polar phosphate group along with two hydrocarbon chains is considered a _…
70 What happens to the transcription process in bacteria if the sigma subunit of the RNA polymerase was…
71 Which of the following is true for both Gram-positive and Gram-negative bacteria?…
72 Which of the following statements about the nucleoid is/are TRUE:…
74 The <i>fooA</i> gene has a single promoter. If this promoter was moved, so that it is downstream fro…
79 If you wanted to examine the morphology of a bacterium and determine its Gram stain reaction, you wo…
80 Pasteur was doing research for what institutions when he proposed the germ theory of disease?…
81 Which of the following is not a reason to study microbes…
82 What scientist first observed microorganisms and described them in detail using a microscope he made…
83 He created the compound microscope and observed fleas, molds, and plants among other things. He publ…
84 He and his laboratory created many of the microbiology techniques that we still use. These include s…
85 Variolation was a common practice in India and China. However, 1% of patients died from this treatme…
86 Solid growth medium is important in microbial research. Walter and Angelina Hesse developed the use …
87 The germ theory of disease states that…
88 A typical bacterial chromosome, if it were stretched end-to-end, would be about 1.5 mm in length. Th…
89 A major difference between previous, traditional classification systems and molecular phylogeny is t…
90 Dr. Lynn Margulis (and others) proposed that the mitochondrion is actually an endosymbiont whose dis…
91 Horizontal gene transfer (HGT) makes the concept of species in bacteria more difficult because…
92 If the environmental temperature rises a bacterium will stabilize the membrane by…
93 Bacterial sigma factors are important to…
94 Capsules and fimbriae share this function in common…
95 The cause of some infectious neurological illnesses such as Mad Cow Disease and Chronic Wasting Dise…
96 The figure shows the chemical structure of <img src="/images/quickcheck/LPS.png" />…
97 A rod-shaped cell has a mutation such that when the temperature is raised above 37°C, it can no long…
98 Many microorganisms, including E. coli exhibit chemotaxis. If you placed a tube filled with glucose …
99 Porins are only found in Gram-negative bacteria, their role is…
100 Major cellular differences between Eukarya and Archaea include…
101 Major cellular differences between Archaea and Bacteria are…
102 A difference between transport via group translocation and an ABC transporter is…
103 A new strain of penicillin-resistant <i>Staphylococcus aureus</i> has emerged. Your lab is frantical…
104 While there are many similarities in viruses that infect plants, animals, and bacteria, which of the…
105 Animal viruses can enter cells in a manner that is unique to animal cells. This method is by…
106 What is the lowest powered method that would allow you to see the structure of a protein?…
107 The insulin gene, including its promoter and terminator, is cloned from a human pancreas cell into <…
108 You create a pool of mutants such that each one changes one base pair in the coding region of in the…
109 Many Bacteria have either a Gram-negative or Gram-positive cell wall structure. However, there are g…
110 When a Flagella moves, it can move counterclockwise or clockwise. If it moves counterclockwise, what…
111 A cell in a warm environment, has a semi-permeable membrane that is ......in permeability than a cel…
112 Based on size what is the correct order of the following? (Smallest on the left to largest on the ri…
114 Which of the following best describes Archaea?…
115 The archaea cell membrane contains _______ lipids.…
116 Which is true in regard to microbes?…
117 Which of the following is a true statement regarding cellular transport processes?…
120 Suppose a hypothetical bacteria grows normal at 25 C and has a membrane lipid composition of 50% SFA…
121 You are working in a research lab this summer and your project is to isolate and characterize the en…
123 You cut two small wells into an agar plate and fill one well with a bacterial strain while filling t…
124 If Thonis Philipszoon had discovered microbes during the industrial revolution, would the cultivatio…
125 You are looking at a new strain of <i>Salmonella enterica</i> that was isolated from the latest outb…
126 A lipopolysaccharide layer can be found in some ________ walls.…
127 With which domain does archaea share the most molecular features?…
128 Both Gram-Negative and Gram-Positive cells have what structure in common?…
129 Which one of these is an important difference between animal viruses and bacteriophages?…
130 A major difference between facilitated diffusion and group translocation is...…
131 The proton gradient used to generate ATP is called the proton-motive force. How is it created in oxi…
192 What are iron-sulfur complexes used for?…
193 What are the end products of Emden-Meyerhoff-Parnas Pathway?…
194 Oh no! There is a severe drought in the forecast for an environment where a lot of photosynthetic ba…
195 Here are the two half-reactions. Predict flow of electrons and the electron potential drop</p> <t…
196 Due to a large amount of garbage dumped into the ocean, a large sulfide production zone appears. You…
197 How much free energy do you think is available at standard conditions to do work in the case of sulf…
198 A class of bacteria ferment butyrate to acetate and hydrogen gas. These microbes grow much faster in…
199 In general cells create energy by…
200 A major difference between substrate level phosphorylation (SLP) and oxidative phosphorylation (OP) …
201 ATP synthase works by……
202 The wild fermentations of chocolate and Kim Chee involve successive fermentations by a number of dif…
203 In cheese making and yogurt production, homofermentative bacteria ferment sugars to…
204 You brew a batch of beer and want to make it high in alcohol content. The brewing seems to go fine, …
205 The <b>most important</b> role of carotenoids in photosynthesis is to…
206 In photosynthesis the light harvesting apparatus is used to…
207 What molecules in the reaction center actually ejects a high energy electron upon excitation by phot…
208 A new bacterium was discovered that grows on hydrogen gas and converts nitrate (NO3-) to nitrogen ga…
209 A new bacterium was discovered that grows on hydrogen gas and converts nitrate (NO<sub>3</sub><sup>-…
210 As part of respiration, protons are translocated across the membrane to create a proton gradient. On…
211 What physical method would you use to remove microorganisms from a solution of tetracycline? (Tetrac…
212 The unimaginable has happened and it's every man and woman for themselves in a zombie apocalypse. Yo…
213 Green bacteria contain a chlorosome. What structure in cyanobacteria serves the same purpose?…
214 <img alt="The fermentation pathway of bifidobacterium" src="https://instruction.bact.wisc.edu/images…
215 Which group of photosynthetic bacteria can grow as Photoheterotrophic organotrophs?…
216 What function do retinal-based phototrophy and purple bacteria photosynthesis share?…
217 A budding graduate student is preparing a medium to grow <i>E. coli</i>. To one liter of water he a…
218 A medium that contains a high concentration of nutrients where the exact amounts of are not complete…
219 Use the data shown below. Calculate the growth rate (k) for Medium 1 and Medium 2</p> <table clas…
220 You have a microbe that does not divide by binary fission, but instead forms long filaments. How cou…
221 Most microbes that live in the environment…
222 A microbe that can grow at a pH of 10 and a sodium bicarbonate concentration of 2 M would be conside…
223 Cells are killed at high temperatures because…
224 Halophiles and halotolerant bacteria protect themselves from high solute concentrations by…
225 Aerobes can survive in the presence of oxygen because…
226 When nutrients become unavailable microorganisms can react by in a number of ways. Which of the foll…
227 Of the following resting structures, which do you think are most resistant to heat?…
228 The cyanobacterium <i>Anabaena variabilis</i> forms long filaments during growth, under nitrogen lim…
229 The zombie apocalypse continues. You and your band have destroyed the zombies in your area, but one …
230 Which of the following statements about endospores are correct?…
231 <i>Methylococcus capsulatus</i> uses methane as energy source and reducing agent to yield energy by …
232 What is the most likely order of electron flow for oxidative phosphorylation? Hint, use the electron…
233 Which sequence below shows the correct order for the synthesis of ATP through the generation of the …
234 What is a major difference between the role of chlorophyll and carotenoids in a reaction center?…
236 How does ATP synthase use the proton motive force?…
237 When <i>Bacillus</i> species experience nutrient deprivation, they...…
238 Out of the following multi-step reaction listed below, what is the best way to describe the reaction…
241 Which of the following best describes the relationship between trace elements and growth factors…
242 Which of the following correctly describes the role of chlorophyll and/or carotenoids in a reaction …
243 Which of the following best describes how protons move across the cell membrane…
245 The most abundant elements found in all microbes as a percentage of dry weight are, on average:…
246 During __________ a free phosphate group is joined to ADP by ATP synthase using the energy from the …
247 Which is true of the differences and similarities between green bacteria, purple bacteria, and cyano…
248 Which of the following about retinal-based phototrophy is false?…
249 Which of the following is a true statement regarding retinal-based phototrophy and classic photosynt…
250 What is false regarding the photosynthetic apparatus (Reaction Center, Electron Transport Chain and …
252 Which of the following is false about photosynthesis in green and purple bacteria?…
253 Which of the following statements is TRUE regarding respiration and fermentation:…
254 The Archaea <i>Halobacterium salinarum</i> is found in salted fish and hypersaline lakes, high salt …
255 Oxygenic and anoxygenic photosynthesis have many common traits, which of the following is NOT a comm…
256 If you are designing an experiment aimed at isolating and growing with a chemoautolithotroph, whic…
257 E.coli deal with starvation through hibernation, which involves the increase in expression of RpoS (…
259 For your microbiology lab exercise you need to isolate a bacterium from nature, so you decide to col…
261 Which method of ATP production is based on the action of an energy gradient?…
262 Purple bacteria, green bacteria, and cyanobacteria contain many similar light-harvesting centers. Ho…
263 If an organism is able to switch between aerobic and anaerobic respiration but they are in high dema…
264 According to the reduction potential table, which of the following sets of molecules are all capable…
265 Which of the following is not part of the process in which the FtsZ finds the middle?…
266 What environmental stresses do microbes respond to?…
269 Which of the following best describes the metabolism of methane? CH<sub>4</sub>+2O<sub>2</sub>-----…
271 Which of the following steps in the Emden-Meyerhoff (glycolysis) pathway involves an oxidation-reduc…
272 Which of the following is/are made using wild fermentative processes?…
273 If a cell wanted to increase its rate of forward reaction how could it accomplish this?…
275 A microbe degrades toluene and produces NADH, pyruvate, and acetyl-CoA. Which of the following pathw…
277 A new drug is known to destroy the H<sup>+</sup> gradient that forms in the electron transport chain…
278 Which of the following metabolic processes has the highest ATP yield?…
279 Why is oxygen necessary in aerobic cellular respiration?…
281 Which of the following statements about the electron transport chain is correct?…
282 A cell culture of an aerobic bacterium that is respiring glucose was supplied with radioactively lab…
286 Which of the following metabolic pathways uses sunlight to produce ATP and NADH?…
287 Which anoxygenic bacteria reaction centers are most similar to photosystem 1 and 2 in cyanobacteria?…
288 Choose the correct order of electron transport chain elements as well as how these elements generate…
289 Your research partner decides she wants to isolate a culture of Gram-negative bacterium that undergo…
290 In the reaction CH4+ 2O2---> CO2+ Energy+ 2H20 What happens to methane and why?…
291 In the Gibbs Free Energy Equation, &delta;G= &delta;H - T&delta;S, increasing entropy (S) would resu…
292 If you reduce the concentration of products in a reaction, what happens to the rate of reaction and …
293 Which of the following is NOT a common way microbes utilize Hydrogen?…
294 Which of the following is true about the mechanisms of the electron transport chain during cellular …
296 A major difference between aerobic respiration and anaerobic respiration is...…
297 A group of researchers recently isolated a bacterium that they believe has never been studied before…
298 What is the correct order of fermentation progression of Kim Chee?…
299 Anoxygenic photosynthetic organisms use carotenoids for all of the following except..…
300 Which of the following are anoxygenic?…
301 Calculate the generation time of a bacteria at time 3 hours (CFU/ml = 2.00E+07) and time 7 hours (C…
302 Calculate the generation time of a bacteria at time 2 (CFU/ml = 2.00E+06) and time 9 (CFU/ml = 2.43E…
303 You are experiencing a microbial contamination problem in a cheese product you are developing. Whic…
304 NAD is an organic compound that is needed by <em>Leuconostonc mesenteroides</em> in small amounts bu…
305 NAD is an organic compound that is need by humans in small amounts, but can not be made on its own a…
306 What domain(s) are capable of methanogenesis?…
308 When predicting the relative rate of a forward reaction, it is known that increasing the amount of s…
311 Which of the following statements accurately describes the relationship between photosynthesis and o…
312 Making Kim Chee involves the fermentation of cabbage by lactic acid bacteria and coliforms. Which of…
315 Photolithoautotrophs differ from chemoheteroorganotrophs because they get their energy from ___, the…
316 ATP synthase can rotate the F<sub>0</sub> subunit and make ATP by the F<sub>1</sub> subunit under wh…
317 Which of the following about ATP synthase is false...…
319 What following points are true for a favored redox reaction?…
321 You start with a culture of 2.0E+6 E. coli cells at 7:00AM. Before you leave at 5:00PM you count 6.2…
323 Photosynthesis and retinal-based phototrophy both use light to create energy for organism. How are t…
324 The reaction 2NAD(P)H + 2H + O<sub>2</sub> --> NAD(P) + H<sub>2</sub>0 occurs commonly microbes. If …
326 Which of the following processes involve substrate level phosphorylation? The generation of ...…
327 A difference between endospores and cysts is?…
328 How does retinal-based phototrophy make energy from light?…
329 You have a <i>Bacillus</i> strain that assimilates nitrate to obtain the essential element. If a mut…
331 Why are purple bacteria great model systems for studying photosynthesis?…
332 You want to determine whether <I>Alicyclobacillus</i> is more heat resistant than <i>E. coli</i>. To…
334 The most resilient of the resting structures is _______ because_________.…
335 The electron transport chain uses redox reactions to pump protons across the cell membrane to create…
336 Why does a bacterium that is fermenting an organic substrate need to get rid of the excess NADH afte…
343 Which one of these is an important difference between planktonic cells and those living in a biofilm…
344 The electron transport chain in Gram-negative cells is located predominantly in the:…
345 <img src="https://upload.wikimedia.org/wikipedia/commons/b/bb/MaraisSalant.JPG" alt="a sea salt pond…
346 When evaluating growth, one disadvantage of measuring turbidity is that...…
347 Which of the following are end product(s) to glycolysis?…
349 Which of the following states the main difference between the Embden-Meyerhoff and Entner-Douderoff …
350 An alkalophilic bacterium is put into an environment with a low temperature and a high pH level (gre…
351 Which of the following is NOT a benefit of beta-oxidation?…
353 Which of the following responses are not associated with a hibernation approach to nutrient deprivat…
355 How do chlorophyll and carotenoids interact within the cell?…
357 In ethanol fermentation, acetaldehyde is converted into ethanol producing NAD+. In this reaction, th…
358 Which of the following is false regarding anaerobic and aerobic respiration?…
359 Which of the following classified organisms would you NOT expect to find in a mammalian GI tract?…
360 A culture is started in two growth media. Media 1 starts at 1.0E8 and ends after 10 hours at 8.0E9, …
361 NADH redox reduction potentials have a value of -340, while oxygen redox reduction potentials have a…
362 During starvation, microbial cells can undergo several changes while shifting into a hibernation mod…
365 Which of the following ingredients is could not be used in defined culture medium?…
366 Green bacteria and Cyanobacteria do NOT have what structure in common?…
367 What do Purple and Green bacteria NOT share?…
368 Light-harvesting complexes are located adjacent to the reaction centers in purple, green and cyanoba…
369 Which of the following is true about oxygenic photophosphorylation?…
370 All of the following are redox reactions except for:…
372 With these two half reactions, predict which way the reaction goes and the energy yield.<br /> SO4 …
374 Compared to regular photosynthesis light reactions, retinal-based phototrophy is dependent on which …
375 For the given reaction, A + B -> C + D: If the concentrations of A and C were doubled, How would the…
376 Each of these are a product of fermentation except:…
378 How are macronutrients and trace elements similar?…
380 What role do trace elements have in cell nutrition…
382 A microorganism goes into a starvation phase because it detects a lack of nutrients or some environm…
383 Lactic Acid is a major product in fermentation to create all these products EXCEPT which of the foll…
384 In a suspended liquid, you will most likely find__growing:…
385 How do lithotrophs and organotrophs differ?…
388 Which of the factors below could limit any type of bacterial culture growth in an environment...…
389 What type of metabolism is only capable of generating ATP by substrate-level phosphorylation.…
390 In order for an organism to absorb light, all of the structures below are necessary except for?…
391 Aerobic respiration and anaerobic respiration are alike due to which of the following:…
392 Your friend has taken up beer brewing as a hobby and insists you try their latest creation. Hesitant…
393 Two cultures were started in medium 1 and medium 2 at CFU/mL = 9.0E+06. At time 3, the CFU/mL for ba…
395 __________ in the electron transport chain get their electrons from NH Fe proteins and are reduced b…
397 Which of the following enzymes/processes can pump protons across a membrane…
398 Green bacteria and green-sulfur bacteria unlike purple bacteria and the cyanobacteria can photosynth…
400 Johnny Beer Belly was brewing beer but had to rush. His first batch tasted sweet and like cooked cor…
401 You are a young, hip and clever first year graduate student in a microbiology lab. Your PI has asked…
402 In which of these environments would bacteria never be found…
403 in a fermenting organism, how is ATP generated?…
405 A microbiologist wants to see what kinds of microbial life she can develop from things lying around …
406 A medium that supports the growth of many bacteria, but causes some to turn black if they utilize su…
408 A microorganism is isolated from a bog. Sampling from bog water yields Fe<sup>2+</sup> ions and Fe(O…
409 Which of the following is false?…
412 A likely final electron acceptor for aerobic respiration would be _____ and for anaerobic respiratio…
413 Micronutrients are essential for cell life. Which of the follow is a micronutrient which is used as …
414 You want to isolate a mutant bacterial strain of <i>L. mesenteroides</i> that can produce its own gl…
415 A major difference between homofermentation and heterofermentation is...…
416 If a microbe gets energy from the sun, electrons from organic compounds and carbon from organic comp…
417 In Fe/Mn reactions, these atoms serve to be...…
419 Which of the following DNA repair mechanisms generally has the lowest fidelity? What is the most com…
420 If a gene with the letters AAA (coding for Lysine) undergoes a point mutation to TAA (coding for a S…
424 You are given a sequence of DNA, but there is a mutation. Instead of one of the codons in the coding…
425 In microbial diversity, most primary producers in the ocean are _______ that obtain energy from ____…
426 A culture plate that only allows growth of a specific mutant microbe is an example of _________, and…
427 Were you to swim to the bottom of the marina trench and feed a tube worm a respiratory poison (oh th…
430 A researcher wanted to confirm the size of the gene sequence that they transformed into a bacteria's…
431 Because of the low pH, and presence of only minerals, chemoheterotrophic microorganisms are not foun…
432 In heat shock, the degradation of RpoH is an example of…
433 You are investigating a new operon that expresses proteins involved in arabinose catabolism. You fin…
434 In negative regulation, the regulating protein is called a…
435 MalT, in the presence of its signal molecule, binds to DNA and recruits RNA polymerase to the site. …
436 A strain carrying a frame-shift mutation in lacA would…
437 A strain is made carrying two mutations. One mutation is in <em>lacI</em> such that LacI behaves as …
438 A point mutation in the <em>trp</em> repressor (TrpR) is made so that it can no longer recognize its…
439 A point mutation in the trp repressor (TrpR) is made so that it can no long recognize its co-repress…
440 The three activities that are found in two-component systems are…
441 Proteins involved in the heat shock response fall into a number of categories. Which of the followin…
442 A point mutation is made in DnaK such that it can no longer bind to RpoH. This would likely…
443 Which of the following statements about quorum sensing are false.…
444 If the luxR gene of <i>Vibrio fischeri</i> is deleted. The strain would…
445 A point mutation is made in <em>agrD</em> such that the AIP no longer binds to AgrC. In this case, t…
446 A new bacterium has just been isolated. <em>Fredrica deermenii</em>. It's entire genome was sequence…
447 Which of the following are true for low copy number plasmids…
448 Which of the following is not true for DNA replication…
449 The mutation in the figure was probably caused by<br /> <img alt="A piece of DNA where T is mistake…
450 The system that would be used to repair a mutation in the DNA where two adjacent thymines have aberr…
451 You are interested in increasing the production of arginine (an amino acid) from a strain for its in…
452 Of the 3 methods of horizontal gene transfer we looked at, which one involves naked DNA in the envir…
453 You think that resistance to tetracycline is developing in the bacterial microbiota of cattle at a d…
454 If the untranslated region of an mRNA transcript that is controlled by a riboswitch is removed, it w…
455 Mutations in DNA can cause…
457 You are investigating the pollution of an environment with polychlorinated biphenyls (PCBs). You wan…
458 <i>Leptospirillum</i> sp. are found in the acid mine. Which of the following statements about the ba…
459 An amazing property of the respiratory chain of Acidithiobacillus ferroxidans , which uses Fe2+ as t…
460 A survey of the phylotypes of bacteria present in the soil shows that …
461 When comparing cellulose degradation aerobically vs. anaerobically…
462 Lignin degradation is different than cellulose degradation in that…
463 Which of the following is true…
464 <i>Peligabacter ubique</i> is…
465 Much of the photosynthesis that occurs in the oceans is done by…
466 When examining the deep sea ocean vent environment the kinds of life forms found are…
467 In the reductive acetyl-CoA pathway, the source of reducing power is ____________ and the final prod…
468 In comparing aerobic vs anaerobic methane oxidation, the major difference is that…
469 Which one of the following facts about the anammox reaction is false…
470 Which of the following statements about the nitrogen cycle is false…
471 Suppose you are looking for the phenotype of an <i>E. coli</i> strain that contains a transposable e…
472 Which of the following genes must be found on the chromosome of a bacterium?…
473 Given a DNA coding sequence of 5’ATG CTA TGC TTC TAG 3’, what type of mutations would occur if base …
474 Under what conditions would the lactose operon be turned on?…
475 An error in DNA replication replaces cytosine with thymine in the CGA codon. The resulting TGA codon…
476 Which of the following characteristics are shared by all deep sea microbes?…
479 Plants are to soil like _____ is to lakes, and they are both considered _________.…
480 A deletion mutation in trpB would…
481 One way plasmids ensure that they get passed on to daughter cells is by using a toxin-antitoxin syst…
482 A strand of DNA has the following mutation:</p>  </p> <p><img src="https://instruction.bact.wisc.e…
483 A researcher has collected a sample of compost and wants to determine the number and identity of bac…
484 How does Aliivibrio fischeri, a bioluminescent bacterium, use quorum sensing to regulate the transcr…
485 You discover that your bacterial specimen has acquired a mutation in its DNA sequence and determine …
486 Which of the following is a similarity between transduction and transformation for pieces of DNA tha…
487 There has been an insertion of an incorrect base during replication in a DNA chromosome. Which of th…
488 A mutation in the<em> luxI</em> gene of <em>V. fischeri</em> has substantially decreased its activit…
489 If a cell has a nonsense mutation in the <i>trpR</i> gene, will there be higher, lower, or equivalen…
491 You are investigating a new operon that synthesizes ladderines. You find that the final product bind…
494 A mutation in the maltose activator protein occurred so that it could not bind to the maltose operon…
496 You over-hear your lab partner telling his parents that bacteriorhodopsin is a type of photosynthesi…
499 What will most likely happen to the squid if you have a nonsense mutation in the middle of <i>luxR<…
500 Which one of these is NOT a method that microorganisms use to control gene expression:…
501 You sequence the entire genome of an unknown microbe and discover multiple genes that are 80% conser…
503 What method of DNA repair will be used to fix a deleted base pair mutation?…
504 When a mutation in DNA causes both strands to be damaged in the same region and DNA polymerase to st…
506 Rhodopsins maintain energy balance in lake and ocean environments by:…
507 You are going to Mexico for spring break and want to be tan before you get there, so you decide to s…
508 Which of the following is a difference between a chromosome and a plasmid?…
509 If a mutant has a frameshift mutation in <i>malT</i> from the maltose operon, which of the following…
510 In which situation(s) is quorum sensing most advantageous for operon expression in a bacterial popul…
513 A crucial microbe in the low-light, deep sea regions of the ocean may include…
514 Generating free radicals is important to lignin degradation because:…
516 Which of the following is false about attenuation?…
517 A plasmid encodes a toxin-antitoxin system. After replication of a plasmid, the segregation process …
519 Nitrogen fixation converts nitrogen gas to ammonia. Some of this escapes into the environment. Howev…
520 Which microorganism will you NOT find in an acid mine?…
521 Which of the following is false regarding Nitrospira?…
522 A single base-pair mistake in DNA replication caused a stop codon to be present in the middle of a D…
524 Acetyl-CoA is an allosteric activator of Pyruvate Carboxylase. How would enzyme activity be affecte…
525 The trp repressor is inactive and cannot bind to the operator when…
527 A <i>Staphylococcus aureus</i> cell transfers DNA to a neighboring <em>Staphylococcus aureus</em> ce…
528 While sequencing a DNA strand from a nature isolate, you accidentally contaminate the sample with tr…
530 In an experimental setting mice are injected with a heat killed, lethal, capsule-containing variatio…
531 A pyrimidine dimer mutation is formed. This was most likely caused by ______ and will most likely be…
532 Why do fungi use a lignin peroxidase to break apart lignin instead of a lignin enzyme?…
533 Before mutation, a DNA sequence codes for the protein arginine when translated and transcribed. Afte…
534 If a DNA coding sequence of a gene was mutated so that instead of reading 5' TAAGTAAACCCG 3' it read…
535 A deletion mutation in trpD would…
536 Which of the below processes involve a riboswitch regulating gene expression?…
537 Plasmids and chromosomes both encode for DNA in bacteria, non-essential and essential respectively. …
538 Plasmids are "selfish DNA". What about them makes them virus-like?…
539 If a strain is growing on a Rich medium lacking both glucose and lactose, what would CRP (also known…
540 A deletion mutation inactivates <em>lacZ</em> of the <em>lac</em> operon. What would happen to the c…
541 What is the primary function of the TrpR regulatory protein?…
543 Would the elimination of microbial rhodopsins from lakes be beneficial or detrimental to large lake …
544 Horizontal gene transfer occurs in several different ways. What are those ways?…
546 Operons that exhibit catabolite repression are under control of the catabolic activator protein (CAP…
547 In an oligotrophic lake how do <i>Anabaena</i> species get their energy?…
548 In catabolite repression, RNA polymerase is recruited by cAMP:CAP to various promoters when the aden…
549 A mutation in the <i>trp</i> operon causes TrpR to be synthesized in a high concentration of tryptop…
551 You have a system where a small metabolite thiamine pyrophosphate (TPP) binds to the mRNA that encod…
552 Which form of repair would be used to reverse TT dimers?…
555 Which of the following is NOT a category of heat shock proteins?…
556 If the antisense RNA SymR in <i>E. coli</i> was mutated and could no longer bind to its complementar…
557 Which of the following is not a characteristic of Bacteriorhodopsin?…
558 If the temperature increases in an environment what would happen to RpoH in the heat-shock response?…
559 At low temperatures, the mRNA translation of RpoH...…
561 You are examining a newly isolated bacterium and observe some variation within the population. Some …
563 Dr. Brown, a pathologist, wants to detect a specific bacterial pathogen they suscpect is present in …
565 A loop is formed on mRNA that includes the Shine Delgarno sequence. The increase of a metabolite cau…
566 What might cause a T-T base pairing and how might this mutation be fixed?…
568 DNA can experience errors, and damage. Nucleotide excision repair is a system that can repair DNA. …
569 What benefit(s) do bacterial cells gain from quorum sensing?…
570 What kind of repair is used when an area of DNA is damaged, and the corresponding strand is also dam…
571 What difference in cellulose and lignin structure causes one to use a unique peroxidase that generat…
573 What system are newly developed antibiotics targeting?…
575 What provides the additional energy needed by <i>Peligabacter</i> SARI I for all the biomass in the …
576 How does the regulation of a catabolic operon differ from how an anabolic operon is regulated?…
578 <i>Hungari miconodance</i>, a lethal species of bacteria to mice, was grown in a lab. The bacterium…
581 A point mutation in TrpC would…
582 Under what conditions would the lac operon be expressed in <i>E. coli</i>?…
584 While mutations are rare, changes to an organism's DNA sequence do occur. Of the following, which is…
586 Consider the <i>Staphylococcus aureus </i>model of quorum sensing. If the <i>agrA</i> gene is altere…
587 Which of the following is TRUE for processes carried out by microbes in soil environments?…
589 If there was a mutation in quorum sensing system of <i>S. aureus</i> inhibiting AgrC from phosphoryl…
591 Recent work by scientists has discovered a microbe in a cave. They want to identify what this microb…
592 You want to fix a pyrimidine dimer mutation, which of the following is the best system for repair?…
593 What type of RNA bonds to mRNA and disrupts the translation in a cell?…
594 The <i>symE</i> gene of <i>E. coli</i> causes the degradation of all mRNA. The <i>symR</i> encodes a…
595 Northern Minnesota is known for having beautiful lakes with little algae, deep, clear water, and san…
597 Which of the following uses the bioinformatic definition of a species?…
598 In order for Transcription to occur in the Mal operon, which of the following events need to occur.…
600 Which of the following is false in regards to the primary producers in acid mines?…
601 A mutagen that causes various modified bases would most likely use what method to repair the DNA?…
602 What would be a possible outcome of a mutation of sequence #2, so that it could no longer hybridize …
603 Modifications are made to the <em>rpoH</em> gene such that its mRNA loses all secondary structure, b…
604 Which of the following statements is true about Oligotrophic, Mesotrophic, and Eutrophic lakes?…
605 What is the phenotypic consequence a mutation that removes LuxAB in quorum sensing for <i>Vibrio fis…
608 Scientists recently discovered a protein in <i>E. coli</i> that provides antibiotic resistance to Ci…
610 What is the major difference between chromosomes and plasmids?…
611 In catabolite repression, a cAMP-CAP complex is required to be present, if a mutation occurred and t…
612 If you wanted to design an experiment to survey the number of types of bacteria in a particular pond…
614 Which cellulose degradation system allows the organism to obtain glucose most efficiently?…
616 Light-sensitive pigments include _____(1)_____, and bacteriorhodopsin contains _____(2)______.…
617 You have an E. coli strain that contains a frameshift mutation in the CRP gene (also known as CAP). …
619 Which of the following is NOT an approach ecology takes to explain microbes interactions and distrib…
620 Which of the following is NOT an approach ecology takes to explain microbes interactions and distrib…
621 Which of the following qualities of chemolithoautotrophs makes it possible for chemoheteroorganotrop…
622 In Quorum sensing in <i>V. fischeir</i>, when the concentration AHL is high, this causes...…
623 What nitrogen compound is used as an electron acceptor in both denitrification and the anammox react…
624 Deletion of the <i>trpR</i> gene of the tryptophan operon would…
625 In the <i>trp</i> operon of an <i>E. coli</i> cell, you have a double mutant. One mutation is a dele…
628 As you were walking through the woods one day you come across a soil that is bright pink. You collec…
629 Which of these statements is TRUE concerning horizontal gene transfer?…
632 A group of scientists is studying a strain of <i>E. coli</i> which was exposed to radiation and deve…
634 Why is cellulose degradation using cellulosomes so effective?…
635 What type of mutation is caused by an addition or deletion of a base in a polypeptide-encoding part…
636 Which of the following is true about negative regulation?…
637 If <i>Vibrio fishcheri</i> had a mutation that deactivated luxl activity, the phenotypic outcome wou…
638 The function of _____________ is to disrupt translation by binding to mRNA.…
639 Which of the following is NOT an example of Transformation in horizontal gene transfer?…
640 In antisense RNA, the difference between cis and trans transcript regulators is that:…
641 Which of the following is correct?…
642 What is the correct scenario in which the trp operon becomes transcribed?…
643 Which of the following would be least likely to be used as an electron donor by a microorganism livi…
644 What is the purpose of using free radicals for the degradation of lignin in fungus?…
646 What happens when antisense RNA does not bind well to its target?…
647 Which of the following is NOT a characteristic of the plasmid to ensure that it is passed on to the …
651 You are a first year graduate student at the University of Hawaii in Maui, soaking up sun, culture a…
652 You have just returned from a trip for which you have obtained organisms living in the same habitat …
653 How can chemoheteroorganotrophs live in the deep sea?…
654 While plasmid segregation works to ensure that most offspring receive a copy of the plasmid, either …
656 Why would a tube worm die if a respiratory poison were introduced to it?…
657 There are 2 types of negative regulation. What makes Induction different from repression?…
661 With catabolic operons, excess of substrate will will trigger the ____ of catabolic enzymes, while i…
662 In nitrogen fixation, _________________ is converted to ammonia. This requires energy in the form of…
663 If you compare the ammonia-oxidizing bacteria to Nitrite-oxidizing bacteria, one thing they have in …
664 You are investigating farm fields in northern Scotland that do not respond to fertilization with amm…
665 Methylotrophs are chemolithoautotrophs. They generate their ATP and reducing power using methane as …
666 What product of symbiotic methanotrophs metabolism is of interest to the sphagnum moss?…
667 You have a strain that has been engineered to produce diesel fuel. You want to test several of the p…
668 In acetogens, a common electron donor is hydrogen, and the electron acceptor is carbon dioxide. Howe…
669 An interesting feature of acetogenesis that is not found in methanogenesis is that…
670 In the rumen, the carbohydrates ingested are converted by the microbial flora into _____________ for…
671 Primary symbionts are found in many insect species. These microbes…
672 There are all sorts of metabolic partnerships in the environment. In all cases,…
673 <i>Syntrophomonas</i> oxidizes butyrate anaerobically, producing acetate as an end product in the fo…
674 In the Beowolf digger wasps the Actinomycetes that grow on them are…
675 In modern microbiology, when investigating a holobiont, the microbial partners of a host are often d…
676 Which one of the following is not a role of the human microbiota…
677 If you examine the normal human microbiota of the skin…
678 One contributing factor to obesity is the host microbiome. This is thought to be true because…
679 The presence of <i>Akkermansia muciniphila</i> in human gut…
680 The gut microbiome has been found to have a role in heart disease (cardiovascular disease). This is …
681 The complement cascade can be triggered by…
682 Microbe-associated molecular patterns (MAMPs) are recognized by…
683 One of the reasons the skin is such a difficult system to penetrate is…
684 Once a pathogen is ingested into a phagocyte, the phagosome fuses with the lysosome. Which of the fo…
685 A critical part of the innate immune response that focuses the rest of the immune system on the path…
686 These are small proteins and peptides created by various immune cells to communicate with other cell…
687 Which of the following statements about adaptive immunity is false?…
688 Which one of these cells types has roles in both the innate and adaptive immune response?…
689 You are in the process of being infected with <i>Streptococcus pyogenes</i>. Certain cells obtain pi…
690 Of the following places, presentation of an antigen to the immune system would most likely occur in …
691 Once present in the lymph node, antigen will be exposed to various cells and will activate ________ …
692 Most activated B-cells will differentiate into…
693 T-cell receptor is to T-cell as __________ is to B-cell…
694 A virally infected cell signals to the immune system that it is infected by…
695 The cell that will respond to a virally infected cell and induce it to enter apoptosis is a…
696 The human immune system can respond to millions of different antigens. Part of this diversity in the…
697 Antibodies inhibit or kill pathogens by…
698 An epidemic of dancing flubitis has overtaken Madison. Victims get an overwhelming urge to perform t…
699 The difference between a pathogen and a commensal microorganism…
700 A crazy billionaire has dared you to drink a bacterial toxin and is willing to pay you $100,000 if y…
701 The disease is caused by a DNA virus and can lead to transformation of cells to cause cancer. The ca…
702 Rounds of repeated lysis of red blood cells lead to cyclic symptoms in this vector-borne disease. Th…
703 Using a microbiota transplant has been an effective means of treating the disease caused by this bac…
704 This common sexually transmitted infection that is spread by elementary bodies and replicates using …
705 A difference between rhinovirus and influenza virus is…
706 The influenza virus that arose in 2009 (H1N1) was of great concern for its potential to cause a pand…
707 Prion diseases when compared to other infectious disease are unique because…
708 This virus replicates by having it's (+) strand RNA virus made into a polyprotein that is then degra…
709 EHEC attaches tightly to the…
710 When humans shifted from hunter-gatherer societies (HGS) to agricultural societies (AS), epidemics i…
711 John Snow's experiments near the Broad Street Pump demonstrated…
712 Ciprofloxacin a fluoroquinolone targets…
713 You are tracking an epidemic. At the right are the results showing the incidence of the disease over…
714 You need to stop an influenza pandemic of a new deadly strain of the virus. Some politicians are pro…
715 Vaccines have been developed against numerous diseases. One of the below statements describes a vacc…
716 There are individuals in our society who cannot be vaccinated against certain diseases or many disea…
717 Looking at the graph on the right, which public health intervention do you think would be most usefu…
718 Which of the following is FALSE regarding disease?…
719 What phagocytic cells are the first to be recruited to an infection?…
720 What phagocytic cells are responsible for removing our own dead cells when they reach the end of the…
721 A steak loving man was found to have high levels of TMAO in his blood. In order to resolve this prob…
723 In mice fed dietary choline, it was discovered that increased labeled TMAO was produced. These mice …
724 The oral cavity and the lower GI tract both contain large microbial populations. What two shared pro…
725 Under what conditions do acetogens become the dominant consumer in an environment?…
726 How does the immune system distinguish between foreign cells and your body's own cells?…
727 Which of the following best explains how the complement system destroys foreign microbes?…
728 If all microbes were removed in a human, what be the effect on the immune system?…
729 In order for a pathogen to cause disease in a host, it must avoid the host immune system. All of the…
730 One way a pathogen could outsmart the adaptive immune system would be to use…
731 Neutrophils are best described as being:…
732 If a virus, such as HIV, destroys the body's T-lymphocytes, to which type of diseases would the pati…
733 Which of the following is true regarding passive and active immunity?…
734 Which of the following is not part of T cell activation and killing?…
735 Which of the following is a potential complication of Chlamydia infection in humans?…
736 What is a major difference in <i>Chlamydia trachomatis</i> and <i>Plasmodium</i>?…
737 Which of the following factors could be used used by pathogens to avoid the innate immune system. …
738 If someone accidentally fell into a pool of ethanol killing all of the microbes living on the surfac…
740 If you look at the above challenges to the immune system in which one does humoral immunity play the…
742 Which of the following statements accurately depicts a form of the adaptive immune response?…
744 <i>Chlamydia trachomatis</i> is a very prevalent disease that can cause sterility in women. What is …
745 Which of the following would be an example of a disease reservoir?…
748 Which of the following statements is FALSE when comparing <i>Clostridium difficile</i> (CD) to <i>Es…
749 If someone uses a needle to inject heroin and then passes it to his friend to use immediately after…
750 A particular environment is abundant in both methanogens and acetogens. There is little aerobic resp…
751 What purpose does that capsule serve in fending off the immune system of the host?…
752 Which of the following is FALSE regarding the microbe <i>Staphylococcus</i>?…
753 If a virus infects an mucosal epithelial cell in the human body, which of the following events is li…
755 Which of the following is a possible way a microbe would be able to survive inside a phagocyte?…
756 Which of the following statements are true regarding the oral cavity and oral microbiota?…
757 Which option lists the events of <i>Plasmodium</i> life cycle in the correct order? 1) Sporozoites…
759 Which of the following about EHEC (Enterohemorrhagic E. coli) is false?…
761 Which of the following is an example of syntrophy?…
762 Explain how an microbe could survive inside a phagocyte.…
764 All of these are correct about disease, except:…
765 Human Papillomavirus (HPV) can progress to cervical cancer in women by…
766 What stage of development of the protozoan pathogen <i>Plasmodium falciparum</i>, transmitted by <i>…
768 Skin tissue has become swollen, red, hot, and painful. This is because:…
769 Which microbe can be sexually transmitted?…
770 What is the purpose of secondary immune tissue, such as the lymph nodes?…
771 A microbe causes a disease in humans, but only when the host has recently been victim to a bad burn …
772 A microbe is a resident of 50% of individuals, yet sometimes causes infection. This is an example of…
774 The complement proteins are produced in all of the following EXCEPT:…
775 A patient comes into the Emergency Room with a red bull’s eye rash with flu like systems. After ques…
776 Which disease is the main cause of infectious diarrhea after hospitalization and antibiotic use?…
777 Danio rero fish ( Zebra fish) develop abnormalities when they are raised in a germ-free environment …
778 If Methanogens and acetogens are both in an environment at with low substrate concentrations (carbon…
779 A young woman’s Pap smear showed aberrant cells. This created concern that she may later develop cer…
780 Which of the following functions would most likely continue to occur normally after the removal of t…
781 Which of the following is <b>not</b> an example of microbial metabolic partnerships (syntrophy)…
782 When <i>Staphyloccocus epidermidis</i> infects the skin of a healthy individual this is an example o…
783 What sexually transmitted disease is the cause of cervical cancer in women and penile, anal, head, a…
784 Individuals that lack <i>Akkermansia muciniphila</i> in their normal microbiota:…
785 Microbial partners play important roles in eukaryotes and prokaryotes, which is a benefit shared by …
786 EHEC uses a type III secretion system (T3SS) to...…
787 Why is <i>Borrelia burgdorferi</i> considered a primary pathogen?…
788 Which section of the GI tract has the most conserved microbiome between individuals, plays a role in…
790 An entity recognizes a foreign antigen displayed on a MHCI complex of a cell infected with an intrac…
791 You want to conduct a study to determine if lack of <i>Akkermansia muciniphila</i> causes disease or…
792 How do pathogens use secretion systems?…
793 In comparing all the diseases we covered in lecture, which bacterium behaves most like a virus?…
794 Mike has noticed a bull's eye-like rash on his leg and has a fever and other flu-like symptoms for t…
796 Just outside of Madison, there are several farms that specialize in growing soybeans. A microbiologi…
797 Which of the following is an example of an exotoxin producing cells that makes Shiga Toxin and how d…
798 A major difference between Chronic Wasting Disease and Human papillomavirus is...…
799 What is an example of a adherence factor used to facilitate attachment of a microbial pathogen to ho…
800 A pathogenic microorganism has infected a host and is causing extensive damage by inhibiting protein…
801 In which of the following ways would humans be harmed if mutualistic bacteria were removed from the …
802 What systems or organs in the body do not contribute to the immune system?…
803 Why do lipids make poor antigens?…
804 Treatment with cephalosporins is correlated with infection with <i>Clostridium difficle</i>. This is…
805 When comparing the oral microbiome to the rest of the GI tract it is distinct in that…
806 The GI microbiome of a cow has a more profound impact on their nutrition than in humans. However, th…
808 Which of the following can serve as adherence factors to facilitate attachment of a microbial pathog…
809 Vegans, when fed a steak dinner, do not have a spike in TMAO. Meat eating individuals, when fed the …
810 Toxic shock syndrome is caused by what microbe?…
811 A person is at risk of a nosocomial infection, such as MRSA, in which of the following settings:…
814 Enterohemorrhagic <i>E. coli</i> (EHEC) violates Koch's postulates for pathogen categorization becau…
815 Which of the following is FALSE about inflammation?…
817 How is the metabolic role of microbes different between humans and ruminant animals?…
818 Tara, a vegan, goes to a cocktail party and decides today is the day she will consume red meat! Afte…
819 Two microbes are isolated and found to be in a cooperative producer-consumer relationship in which t…
820 Why is Influenza difficult to develop a permanent vaccine for?…
821 Which of the following is not an example of a virulence factor in <i>Salmonella enterica</i>?…
822 All of the following are reservoirs except:…
824 Which of the following is a virulence factor of <em>B. burgdorferi</em>…
825 What is the difference between an endotoxin and a exotoxin?…
826 Which one of the following would never be considered a virulence factor?…
827 Which of the following is not a protozoa that can cause malaria?…
829 Which type of immune response listed below is not inducible?…
831 What are the differences between endotoxins and exotoxins?…
832 Which of the following diseases is NOT potentially caused by <i>Staphylococcus aureus</i>?…
833 You discover a pathogen that you suspect is causing a disease outbreak. In order to identify the cau…
834 If all microbes were to be removed from humans, which of the following would be some common repercus…
835 When developing a preventative vaccine that trains your immune system to recognize a particular viru…
836 You are experiencing abdominal pain and bloody diarrhea. Which of the following organisms could you …
837 What is false about antibodies?…
839 An example of an exotoxin is the ______, and it causes damage to a host by ______.…
840 Which of the following is not a phagocyte?…
845 Which of the following is false regarding chlamydia?…
846 Which of the following is an example of a function of a symbiotic microbe?…
848 A major similarity of the oral cavity and the lower GI tract is..…
849 What are the role(s) of mutualistic microbes?…
850 A characteristic of <i>Borrelia burgdorferi</i> that makes the microbe particularly dangerous is...…
852 What is NOT a symptom of EHEC?…
853 After a long day of studying microbio, you walk home and fall out of utter exhaustion, injuring your…
854 You are investigating two organisms and trying to determine their form of respiration based upon the…
855 Which statement below is true?…
856 A(n) ___________ pathogen can live in its host and never cause any trouble, while a(n) ____________ …
857 If all of microbiota is removed from the human body which of the following functions would be affect…
858 If the amount of phosphatidycholine (meat) taken into the body was reduced, what would happen to the…
859 Which of the following is not a mechanism used by your body to detect and respond to presence of a p…
860 Which of the following about complement is false?…
862 Which of the following is not an example of the effects of dysbiosis in humans?…
864 The target of macrolide antibiotics, such as erythromycin, is…
865 An epidemic of cholera has broken out in the Sellery Dorm. Students are dropping like flies and you,…
866 A new potentially pandemic strain of influenza virus has just begun in Madison. Patients that have b…
868 Preventing diphtheria infection is best done by…
869 You ate some under cooked hamburger that was made up of ground meat, and now you are ill with Entero…
870 There has been a dramatic decrease in deaths due to infectious disease in the 20th century. This can…
872 A new disease is spreading across the upper midwest. You are unsure if this is caused by a infected …
873 A nationwide epidemic of Salmonellosis has been reported, with cases occurring in 46 states. After e…
874 There is a higher incidence of infectious disease today than in 1900…
875 The most commonly produced antibiotics are…
876 Fluoroquinolones mode of action is…
877 Rifampicin's mode of action is…
878 Which of the following is not a mechanism that bacteria use to become resistant to an antibiotic?…
879 Why is it sometimes difficult for your immune system to distinguish between self and non-self?…
880 An important difference between humoral immunity (B cells) and cell-mediated immunity (T cells) is……
881 Of the statement's below which is LEAST likely to apply when discussing Humoral Immunity?…
882 You have <i>E. coli</i> (EHEC). You are prescribed an antibiotic. What would be wrong with this trea…
883 Your doctor tells you that you have an elevated risk for CVD. There is a way to lower this risk by c…
884 Which of the following is NOT a way to directly transmit a pathogen to another person?…
885 The immune system is able to react to and destroy foreign microorganisms that enter the body, but do…
886 Which of the following is not one of Koch's postulates?…
887 Which of the following is FALSE about chronic wasting disease?…
890 What is the difference between innate immunity and adaptive immunity?…
891 Which of the following statements is incorrect in regards to microbe survival inside a phagocyte?…
892 Which of the following is not a similarity between methanogenesis and acetogenesis?…
893 What is a reason why the epithelial barrier is an effective first barrier to pathogens in the innate…
894 Chronic wasting disease (CWD), a common infectious disease found in many species of deer and elk wor…
895 Which of the following is not correct about the complement system?…
897 Which barrier listed below is NOT a barrier a pathogen would need to overcome to evade the innate im…
898 In what tissue/skin cells are infectious HPV viral particles released?…
899 A substance is creating a pore in the cell membrane, what could be the cause?…
900 Which combination of molecules detected match the corresponding pattern of recognition (Microbe Asso…
901 Which of the following steps in Influenza A virus replication is not accurate?…
902 How does Chlamydia enter the host?…
903 LPS is an example of ____. It causes damage to the host by ________…
904 Which form of Plasmodium is associated with symptoms of malaria in the blood phase?…
905 Until complement proteins are activated they _________?…
906 Which of the following situations would result in a TMAO spike?…
908 A disease can only be caused by...?…
910 Which one of the following is not a symptom of CWD?…
912 Which of the following is true regarding the influenza virus?…
913 Which of the following is one way a microbe could survive inside a phagocyte?…
915 <i>Staphylococcus epidermidis</i> is a common member of the skin microbiota that colonizes many site…
916 The use of antibiotics on farms to promote more rapid growth of livestock is an important health iss…
917 The rise of a superbug resistant to all know antibiotics is probably inevitable because…
918 Which of the following is the most inclusive definition of a vaccine?…
919 Which of the following does not have an effective vaccine…
920 Vaccines are required by public health departments nationwide before you can enroll your child in pu…
921 All of the following are virulence factors. Which one serves a purpose specifically different from t…
922 An unusual gastrointestinal illness has hit the Midwest. The symptoms include diarrhea, vomiting, an…
923 Hemorrhagic <i>E. coli</i> (EHEC) causes disease, while <i>E. coli</i> (NEC) is also part of our nor…
924 Recently, strains of Methicillin-resistant <em>Staphylococcus aureus</em> (MRSA) are capable of grow…
925 Generally, RNA in the cell is single-stranded, while DNA is double-stranded.…
926 The DNA double helix is stabilized by.…
927 One reason DNA serves to store hereditary material instead of RNA because.…
928 The steps of transcription, in order are.…
929 If you removed the -10 region of the promoter region that sigma-70 RNA polymerase recognizes, the ge…
930 You have a sigma-70 promoter that matches the consensus sequence for that promoter. If you made a ch…
932 Here is a DNA sequence that is known to code for the end of a mRNA.  Does this sequence have a rho-i…
936 The carbonyl linkage is a key component of esters found in cell membranes. A newly discovered toxin …
937 Which of the following is NOT a reason why DNA is used to store hereditary information instead of RN…
938 Which of the following is correct regarding the helpful or harmful effects of microbes?…
939 Microbes have many impacts on the environments and on humans themselves, which of the following is f…
940 A microbe exhibiting chemotaxis should do which of the following when a positive stimulus is introdu…
941 Which of the following is NOT true when regarding chemo taxis?…
942 Which of the following is TRUE with regard to cellular transport processes?…
946 With a living microbe that may be transparent, which type of microscope will provide a higher qualit…
947 Match the microbe with its preferred source of electrons…
948 Topi is a protein that recognizes testis-specific genes of Drosophila (fly). Topi's primary focus is…
949 You are buying a replacement filter for your 12 Survivors Hand Pump Water Purifier. You can get cera…
950 Microorganisms make your life better in many ways. Which of the following is a correct statement the…
951 A major difference between the hydrogen and covalent bonds found within the DNA double helix is that…
952 In another landmark experiment of Louis Pasteur, he demonstrated that injecting chickens with a weak…
954 If a bacteria with a flagella is in the presence of a positive stimuli it will…
955 Why is oxygen critical for aerobic respiration?…
956 Ciprofloxacin is known to inhibit DNA helicase of bacteria. If you could label the molecule and iden…
957 You have a Gram-stained smear from a patient that has a bacterial infection. What scope would you us…
958 A research group has developed a new antibiotic that kills the enzyme that synthesizes lipid A. This…
960 A microbe can no longer transport alanine. You find that this transporter has lost its ability to bi…
961 Which of the following is unique to the Gram-positive cell wall structure…
962 You isolate an organism that is capable of spreading across the plate. Electron microscopy confirms …
963 You are a rising star in the field of microbiology and after discovering a new microbe, you want to …
964 RNA is not commonly used for information storage due to its instability. For a virus with negative s…
965 DNA uses the nucleotide thymine to base pair with adenosine. RNA is transcribed using uracil instead…
966 Which is most likely to show there is an increase in the rate of a reaction forward?…
967 DNA contains triplet codons that code for specific amino acids. How are you able to distinguish amin…
968 Which statement about DNA is incorrect?…
969 Which of the following is NOT a way to distinguish DNA from RNA?…
970 Why is DNA used to store hereditary information?…
971 In bacteria, the cytoskeleton is composed of protein filament structures that are often involved in…
972 Transport proteins are often used to transport molecules through the cell membrane, how do some mole…
974 Predict the order of the following reactions: Pyruvate + 2H+ + 2e- -&gt; lactate cytochrome b (Fe3+)…
975 Which of the following about the Gram Staining process are true?…
976 You have isolated an unidentifiable cell and your task is to determine what domain this cell belongs…
977 What is one way in which Archaea can be distinguished from Bacteria and Eukarya?…
978 Why was there a big time gap between when Thonis Philipszoon discovered microbes and when we began t…
979 All of the following are true statements about the bacterial membranes except…
980 The lab that you work in just discovered a new bacterium. Your goal is to first visualize the bacter…
982 In an experiment, white and black mice were exposed to staphylococcus bacteria. The white mice have…
983 How is ATP produced in substrate-level phosphorylation?…
984 You discovered a strange microorganism. You want to first examine the motile microorganism in its na…
988 Which of the following is FALSE when referring to the Peptidoglycan of a bacterium?…
989 Given the components of the electron transport chain and their reduction potentials, what is the cor…
990 Given the components of the electron transport chain and their reduction potentials, what is the cor…
991 A microbe using chemotaxis changes its direction of motion by…
992 If DNA is used to store information for many organisms, what statement is INCORRECT about the RNA us…
993 In the cell, substrate level phosphorylation (SLP) can occur:…
994 Which is false of substrate-level phosphorylation?…
995 For a typical table vinegar, about 5% to 8% of the content is acetic acid, which is produced by acet…
996 A researcher discovers a new organism with a unique electron transport chain. After investigating th…
997 There was a large gap of time between being able to see microorganisms and being able to cultivate a…
998 Identify the protein sequence from the following mRNA code. Is the sequence positively charged, neg…
999 Which of the following is ordered correctly from largest to smallest?…
1000 Bre, as the frugal college student she is, tried to save some money by brewing her own Kombucha, the…
1001 What properties of agar make it a better media for culturing microbes than gelatin?…
1003 Looking for something fun to do, you decide to compare the relatedness of Gram-positive and Gram-neg…
1005 Which of the following is TRUE of BOTH alcoholic fermentation of glucose performed by yeast and oxid…
1006 Why do active transport processes, ie proton pumps, require energy, while passive transport, ie diff…
1007 Consider the following reaction: 2Ag+(aq)+Cu(s)⇌Cu2+(aq)+2Ag(s) Identify which substrate is being …
1008 Consider the reaction pathway<br /> <img src="http://www.microbiologytext.com/images/book_5/chapter…
1011 Which of the following statement(s) is/are true regarding the structures of DNA and RNA. I. DNA ha…
1015 Consider the formation of lactic acid (via the homofermentative pathway) <img alt="The homofermentat…
1017 Which of the following correctly matches the scientist to the contributions they made for microbiolo…
1019 In your research lab, you are studying the outer membrane of a new bacterial species <i>Microbius ba…
1020 Gram-negative bacteria can release endotoxins but Gram-positives cannot, because…
1021 You discover a new bacterium that uses oxygenic photosynthesis instead of anoxygenic photosynthesis.…
1023 Which term does NOT describe retinal-based phototrophy?…
1024 You discover a new organism that is very similar to other organisms; it has cytochrome b and cytochr…
1026 Which of the following components or bacteria are not associated in retinal-based phototrophy?…
1027 Which of the following is not a way that microbes impact our lives?…
1029 Given the major components of an electron transport chain, and their order, explain why they are in …
1030 A toxin is introduced into a cell where it causes quinones to be unable to bind to the b/c1 complex …
1032 You are attempting to determine whether a microorganism belongs in the Bacteria, Archaea, or Eukarya…
1034 The start of the citric acid cycle begins with pyruvate dehydrogenase, where Pyruvate is converted i…
1036 Which of the following arrangements of the molecules A-D could be used in an electron transport chai…
1037 A mutant <i>E. coli</i> has been discovered to create defective MreB cytoskeletal proteins at higher…
1038 A mutant E. coli has been discovered to create defective MreB cytoskeletal proteins. Which of the fo…
1039 What is the most important result of Tom Brock&#39;s research in Yellowstone National Park?…
1042 Which of the following would result as a consequence of the inhibition of the Na+/K+ ATPase pump in …
1043 Which of the following statements is correct regarding the process of phototphosphorylation in Purpl…
1044 Which of the following statements is correct regarding the process of phototphosphorylation in Purpl…
1045 A major difference between a Eukaryota cell structure and bacterial cell structure is that _________…
1046 One major difference between Bacteria and Eukaryota is that __________…
1047 Bacterial DNA must be contained within the nucleoid. One factor in DNA organization is…
1048 Why is DNA used for hereditary information rather than RNA?…
1049 Most prokaryotes are capable of using fermentation to produce a variety of energy-yielding products …
1050 What is a major similarity between photosynthesis and retinal-based phototrophy?…
1051 Which of the following is true regarding Substrate Level Phosphorylation (SLP) and Oxidative Level P…
1053 Everything is true regarding Substrate level phosphorylation (SLP) and Electron transport level phos…
1054 Which of these pathways contain a redox reaction?…
1055 A mutation changes the first A in the Pribnow box to a guanine in a bacterial promoter region of a …
1057 What is the role of oxygen in aerobic respiration?…
1058 A bacterial cell with flagella is moving freely through an environment is attracted by a newly intro…
1059 Translate this mRNA transcript into its amino acid sequence: 5'-AUG CUA UGU CCC GCC AGU UAU UGA-3'…
1060 Throughout history, beer was made by leaving grains in a covered, sealed container for a long period…
1062 Which of the following are consistent with the process of alcoholic fermentation, as utilized by org…
1063 Which choice best describes the relation between the photosynthetic apparatus for all microbes and p…
1065 Which of the following is the correct sequence of events that occurs to get protons pumped across th…
1068 Which half reaction is most likely to donate electrons to other molecules and why?<br /> <img src="…
1069 The electron transport system generates an electrochemical gradient of protons, which ATP synthase c…
1070 Why would RNA not be a good hereditary material compared to DNA?…
1071 Why would microbes prefer smaller sizes to bigger sizes?…
1073 Which of the following best describes the accuracy of the relationship between light harvesting-comp…
1074 The following components are part of an electron transport chain. Given their reduction potentials,…
1075 H+ are pump out of the cytoplasm towards the outer membrane of a Gram-negative bacterial cell becaus…
1076 Which of the following correctly matches the structures with their location and composition?…
1081 Which of the following statements fits the best description of purple bacteria?…
1082 The fermentation process used to create alcoholic beverages consists of two major steps. Oxidation t…
1083 All of the following are true about fermentation pathways EXCEPT:…
1084 Which of the following is not a reason that DNA is used for hereditary information instead of RNA?…
1085 The flow of electrons within the electron transport chain is coupled to the creation of ATP. If ther…
1086 Which of the following is a major similarity between chlorophyll and heme?…
1088 Which of the following is the correct translation of the mRNA sequence into amino acids? <br />AUG …
1091 Green bacteria collect light using a chlorosome. The analogous structure in Purple bacteria is…
1092 What discovery allowed us to finally characterize microbes, despite them being discovered by Thonis …
1093 Which of the following is a difference between the roles of Fe and Mg in enzyme catalysis?…
1094 A cell carries out an energy yielding metabolic process that produces ethanol. During this this pro…
1095 Which of the following statements is NOT true about the process of Lactic Fermentation?…
1096 Which of the following is not a function of a cell membrane?…
1098 Which of the following would not be a good example of an electron acceptor in a respiratory pathway?…
1099 What is a characteristic that retinal-based phototrophy and classic photosynthesis light reactions s…
1100 Which of the following regarding Gram-positive and Gram-negative Bacteria is INCORRECT?…
1101 How is the electron transport chain used in the photosynthetic apparatus?…
1102 A major difference between Homofermentation and Heterofermentation is…
1103 Oxidative phosphorylation creates an electrochemical gradient by the direct oxidation of...…
1104 For the General Equation 2A + B -&gt; C, given the following concentrations, which direction will th…
1106 The potential energy created by a hydrogen gradient is used to make ATP. Which of the following is …
1107 Where do oxidative phosphorylation and substrate-level phosphorylation get their energy from?…
1108 Why didn't microbiology immediately become a thing after Thonis Philipszoon observed microbes?…
1111 Which of the following amino acid sequences represents the translation of the mRNA molecule below? R…
1112 How does a standard Gram staining process differentiate between Gram-positive and Gram-negative bact…
1113 Which of the following is NOT true of both flagella and pili?…
1114 In aerobic respiration _______ is oxidized, ______ is reduced, and ________ is the energy molecule …
1115 Which of the following reactions would most likely occur in a reaction center during the process of …
1116 Which of the following are not found in both Gram-negative and Gram positive cells?…
1117 You smear a petri dish with two different obligate phototrophs- a purple bacteria (B. Badger) and a …
1118 From the choices I. Purple Bacteria II. Heliobacteria III. Cyanobacteria IV. Green Bacteria …
1119 A prokaryotic organism is able to move randomly, but unable to escape a poison due to a mutated prot…
1120 As an important part of electron transportation, cytochromes contain what that binds an electron to …
1121 which of the following is an example of a redox reaction in the electron transport chain?…
1122 Which of the following statements is false about oxygenic and anoxygenic phosphorylation?…
1124 Which of the following is correct regarding the reduction potentials of the players in the electron …
1127 Who discovered the reason for wine souring and why was this discovery significant?…
1128 Which of the following are characteristics of oxygenic phosphorylation? I Oxygen is released as a b…
1130 Which of the followings is false concerning the roles of chlorophyll and carotenoids?…
1132 DNA's structure is characterized by all of the following EXCEPT:…
1133 Which of the following statements about the cell wall is correct.…
1134 Leptothrix discophora is a freshwater bacteria species known for its ability to use iron and mangane…
1135 Chemotaxis is the directed movement of an organism in response to a ________ stimulus. If an organis…
1137 Which molecule loses an electron in light-dependent reactions?…
1139 Substrate-level phosphorylation which leads to the formation of ATP by the process of transferring a…
1140 Your roommate is sick with the flu and is bashing microbes due to the fact that they caused her sick…
1141 The strands on a DNA double helix gain stability via ____________.…
1142 A major difference between Bacterial And Archaeal cells is that…
1143 Unlike RNA, DNA cannot undergo autocatalytic cleavage due to the fact that...…
1146 Consider transformation, transduction, and conjugation.What of the following statements is correct?…
1148 When using irradiation as a physical method to control microbial growth in food, which method would …
1150 Why might a certain strain of bacteria in the biofilm state be less susceptible to antimicrobials th…
1151 Which of the following statements is false regarding CRISPR cas9 technology?…
1152 Which of these organisms can be classified as photoheterotrophic organotrophs?…
1153 Identify the process of nitrogen fixation as oxidation or reduction, and why it is so.…
1154 Which of the following is false regarding the identification and prediction of ORFs and their functi…
1155 In a laboratory experiment, a transposon insertion in the <em>lac</em> operon is suspected to occur …
1156 Quorum sensing is advantageous to S. aureus in which situation?…
1157 What category of <i>elements</i> often find their use in enzymes as cofactors?…
1158 Your lab isolated a novel microbe that is the most populous bacterium found in the lake. It has neve…
1160 Griffith’s experiment with <em>Streptococcus pneumoniae</em> demonstrated which of the following abo…
1161 How can chemoheteroorganotrophs survive in the deep sea?…
1162 Which of the following genetic experiments is a screen?…
1163 All of these are necessary for anammox respiration EXCEPT:…
1164 which of the following statements is false, regarding plasmids and chromosomes…
1165 In which of the following cases should you use selection? a. To easily identify your mutant by ha…
1166 How is the quorum sensing system in Gram-positive Staphylococcus aureus advantageous to its survival…
1167 You discover a new bacteria while walking along a glacier in the Arctic region. When you place it in…
1169 If there was a mutation in MaIT of the Maltose operon such that it was no longer active, what would …
1170 As an experiment for a class, you decide you would like to perform a bacteriological water analysis …
1171 An mRNA strand contains a riboswitch which, when active, causes the Shine-Dalgarno sequence to form …
1172 You are trying to classify a species, however, the classic definition of a species and the bioinform…
1173 Which regulation category below best describes a system where a co-repressor is used to activate a r…
1174 If organisms capable of nitrification were to no longer exist, what would be a hypothetical impact?…
1175 Studying bacterial resistance, you manipulated conditions to force a species of bacteria to form end…
1176 A cell has an activator that has been mutated. The allosteric site of the activator will no longer b…
1177 You have isolated a strain of bacteria from the soil and have sequenced its genome. Which of the fo…
1178 Which statement INCORRECTLY describes assimilation of carbon dioxide into cell carbon?…
1180 Which type of strategy would you NOT use in milk preparation to minimize microbial growth during sto…
1181 The trp operon is a/n example of a _________while the lac operon is a/n _________. The substrate use…
1183 What happens if microogranisms in a biofilm are no longer able to secrete an exopolysaccharide…
1184 In the <em>agr</em> (accessory gene regulation) system of <em>S. aureus</em>, if AgrC is mutated and…
1185 A researcher is interested in locating a protease gene in the microbe Buckingham badgerii and predic…
1187 When calculating the growth rate of a given set of data, which option is <b>incorrect</b> when utili…
1188 Controlling growth by ionizing radiation or UV light are similar in the sense that they _________, a…
1190 Which of the following are true of both photosynthesis and rhodopsins? I. Utilize light to generate…
1191 Farmer Paustian&rsquo;s germophobic cousin wrote in a letter that he would be visiting today to try …
1192 Bacteria in a medium culture tube is clear throughout the tube except for growth at the top of the t…
1193 Which of the following is NOT a technique we use to preserve food by minimizing microbial growth?…
1194 Enzyme A is allosterically inhibited by it's product when it is in high concentrations in the cell. …
1195 Which of the following are true of Antisense RNA?…
1196 A medium containing bile salts and crystal violet is made. It is later observed that Gram-negative b…
1197 A researcher wishes to determine which microbes on a plate are capable of fermenting lactose. After …
1198 Which of the following compounds can serve as terminal electron acceptors in the deep sea?…
1202 Staphylococcus aureus is a Gram-positive bacterium with an accessory gene regulation (Agr) system/qu…
1203 You just finished sequencing a section of double-stranded DNA from Bacillus badgerii. You have foun…
1204 If a mutation in the genes of <em>Staphylococcus aureus</em> causes AIP not to be made, which is mos…
1205 Which of the following is <strong>not</strong> a common characteristic among primary producers in an…
1206 Part of the nitrogen cycle involves nitrification which converts ____________, and a microbe that ca…
1207 You are designing an experiment to determine if the luxS gene is an essential gene for Lactobacillus…
1208 Which of the following is FALSE?…
1209 What is the growth rate of the culture from 1 pm (X0= 1E+5 CFU/mL) to 8 pm (Xt= 1E+9 CFU/mL) with a …
1210 Both Myxobacteria and Bacillus species form spores as a result of nutrient deprivation. Which of the…
1212 There is a mutation in the trpR gene that causes the gene to be deactivated by binding to tryptophan…
1213 Which of the following reactions do methylotrophs use to obtain energy and carbon?…
1214 In the SymE-SymR toxin-antitoxin system, SymE is a hydrophobic toxin and SymR is a non-coding RNA th…
1215 Your friend identifies a species using the classic definition, and you use bioinformatics. You both …
1216 You figure out your beer is infected with either E. coli (Gram-negative), Staphylococcus aureus (Gra…
1217 What is a distinguishing feature between plasmids and chromosomes?…
1218 Which of the following best explains why application of a respiratory poison to a tube worm would li…
1219 Which of the following is true about the ocean chemistry in deep sea ocean vents?…
1221 Denitrification occurs when there is inadequate _______ and a feasible amount of _______.…
1222 You have an allosteric protein that is activated when substrate A is bound to it. A molecule acts as…
1223 Which of the following scenarios would NOT lead to the restricted growth of a photoautotrophic litho…
1225 You mutagenize a culture with UV light and then plate it onto rich medium + rifampicin. After incuba…
1226 Which of the analogies is/are correct if the following are representative: an operon (DNA) is like a…
1227 What decreases the growth of bacteria, molds and yeast in honey and jam?…
1228 You want to remove bacteria from a liquid that is sensitive to heat. What would be the most effectiv…
1229 A mutation occurs so that that DnaK cannot bind tightly to RpoH (σ-32). Which of the following woul…
1230 If AIP is unable to bind to AgrC will the system still work for quorum sensing?…
1231 Some species of Serratia and Pseudomonas in the soil can deplete soil fertility and reduce agricultu…
1232 What would be the effect of a loss-of-function mutation to DnaK chaperone protein in a high-temperat…
1233 You have been growing organisms under strict nutrient conditions that allows some molecular organism…
1235 A major difference between sterilization and pasteurization is that:…
1236 Which of the following is false regarding the conversion of nitrogen to its various oxidation states…
1237 You are walking in a strange patch of woods and come upon a creature unlike you've ever seen before.…
1238 You have isolated a deletion mutation the malT gene in the maltose operon. What would the effect be …
1239 Methanotrophs live in symbiosis with sphagnum mosses where the contribution of each to this relation…
1241 What enzyme is involved in nitrogen fixation (1) and which type of bacteria need to form a heterocys…
1242 What is a major difference between photosynthesis and light driven proton pumps (rhodopsins)?…
1243 If there is a mutation that causes allolactose to not be able to bind to lacI (repressor protein), w…
1244 Which of the following statements is INCORRECT regarding photosynthesis and rhodopsins?…
1248 Nitrification plays an important role in Nitrogen Fixation. During Nitrification Ammonia is converte…
1249 <table class="table table-striped"> <thead> <tr> <th>Time</th> <th>Medium 1</th> <th>Medium 2…
1250 Conjugation is a form of ____ gene transfer. The recipient is captured and brought in contact with t…
1251 You are preparing to reuse a medical instrument and want to make sure it is sterile. To do this, you…
1252 When referring to attenuation in the regulation of the tryptophan operon it would be safe to say tha…
1253 Which of the following is NOT a group of organisms that can survive in deep sea ocean vents?…
1254 Due to the fact that the structure of lignin is randomly assembled and tough to degrade, how do fung…
1255 A lab grows a culture using a medium that is both selective and differential, which includes bile sa…
1256 Methanogens are anaerobic Archaea that reduce methanogenic substrates to methane, often using hydrog…
1257 Which of the following correctly describes the steps of nitrification and the microbes involved?…
1259 Which of these is a characteristic of both lake and ocean environments, but not of soil environments…
1260 What is Cas9 and what does it do?…
1261 CRISPR-CAS 9 gene editing is a way to edit genes in DNA. It functions in bacterial systems in a way …
1262 Which of the following typically consists of organic compounds?…
1263 While working in the lab you want to measure the growth rate of a planktonic microbial population co…
1264 Griffith's experiment with <i>Streptococcus pneumoniae</i> demonstrated which of the following?…
1265 Which of the following would be the best way to produce large quantities of a protein?…
1266 You are studying a microbe and would like to determine its nutritional classification. You have dete…
1267 Chemoheteroorganotrophs are able to live in the deep sea because:…
1268 You are working in a lab over the summer and inject groups mice with the following virulent <i>Strep…
1270 Why would a tubeworm die if given a respiratory poison?…
1271 A mutation occurs in LuxR of <i>V. fischerii</i> such that its activity decreases by a factor of 5 c…
1272 CRISPR Cas9 was discovered in E.coli as a type of bacterial immune system where sections of viral DN…
1274 How would the introduction of a chemical pollutant that inhibits the utilization of rhodopsins by mi…
1276 The area surrounding an old mine was found to contain acidic water with a pH between 0 and 1. A micr…
1278 Which part of the cellulosome functions in binding the catalytic enzymes to the scaffoldin?…
1279 You grow a bacteria and as expected, the bacteria grew under aerobic conditions. However under anaer…
1280 Biofilm and planktonic cells form aggregative structures during their life cycle in order to…
1282 Which of the following describes a symbiotic relationship between methylotrophs and a higher organis…
1283 Recall that a mutualism is beneficial to both organisms. Which of these accurately describes the met…
1284 What statement is false regarding the nitrogen cycle?…
1286 Which of the following accurately describes the way in which cellulosome enzymes break down cellulos…
1287 Ecology is heavily influenced by physiology and microbial communities. For example, Cellulose, chiti…
1288 An aggregation of Myxobacteria are exposed to low temperatures, dry conditions, and limited nutrient…
1289 You are working in a hospital lab analyzing different organisms commonly seen with diseases. You ar…
1290 Which technique(s) is(are) not useful once you ave located ORFs in a given DNA sequence?…
1291 Which of the following uses a screen to find a desired strain AND has the correct method of action u…
1293 A researcher has treated <em>E. coli</em> cells in order to insert a plasmid containing an ampicilli…
1294 Which of the followings statements of rhodopsin and photosynthesis are true. I. Both rhodopsin and …
1295 Which of the following IS true regarding microbial growth behavior in certain conditions?…
1297 Knowing that acid mine are highly acidic, which of the flowing chemolithoautotrophs would NOT contri…
1298 A major difference between a plasmid and a chromosome is:…
1299 Which of these is the incorrect match between a microbial element and its use within the microbe…
1301 Cyanobacteria is one of the major primary producer in lake environment. Its carbon source is CO<sub>…
1302 Billy needs to sterilize a scalpel for surgery, what method should he use to achieve this?…
1303 Cyanobacteria are MOST likely to be found in:…
1305 which carbon molecule below is the most effective for a cell to produce ATP?…
1307 A major difference in soil and lake environments is…
1308 Which of the following symbiotic relationships demonstrate the reciprocal nature between a methylotr…
1309 What would happen if you raised the temperature a few degrees higher than what a microbe can withsta…
1311 During nitrification, __________ perform the first step of the process by converting _________.…
1312 Which of the following is NOT part of nitrogen fixation?…
1313 Fungi use a lignin peroxidase that generates free radicals and breaks apart lignin instead of a lign…
1316 If a mutation occurs so that the LuxR gene is unable to bind to the auto-inducer, how would this eff…
1317 An environmental scientist is interested in analyzing the properties of an unknown island. When he i…
1318 What do lake, ocean, and soil environments have in common?…
1319 Which of the following is incorrect about CRISPRs safety?…
1320 Which of the following is NOT a reason why chemoheteroorganotrophs can live in the deep sea?…
1321 There is an allosteric Protein A, that is currently unbound to any substrate. When B binds to the pr…
1324 You are studying a novel microorganism that uses hydrogen sulfide as an electron source, carbon diox…
1325 The gene for the protein buckyase is controlled by an allosteric repressor protein (negative regulat…
1327 Which of the following processes could not be responsible for rising nitrogen levels in a lake?…
1328 Which of the following microbes would a farmer NOT want to be found in their fertilizer?…
1329 You collect a soil sample, and you want to see if it contains a target microorganism, <i>Streptomyce…
1330 You are a researcher at the University and are sent out to collect bacteria from a wastewater treatm…
1331 If the amount of phosphorous and/or nitrogen get too high in a lake, this can cause a cyanobacteria …
1332 What do primary producers at a deep sea ocean vent that grow by chemosynthesis have in common with p…
1336 Microbes impact the medical field through the use of vaccines. Which of these vaccination milestones…
1337 What is the main reason that bacteria can complete transcription and translation simultaneously?…
1338 Which of the following sequence differences in the 16S rRNA would most likely be present between mem…
1339 Which of the following statements is INCORRECT regarding the 16S rRNA?…
1340 Which is used as the hereditary material and why?…
1341 During which stage do enveloped viruses obtain their membrane?…
1342 Which protein related to replication is found in &lambda;, but not found in Q&beta; and T4?…
1343 What is the difference between the composition of the capsid of an enveloped virus compared to the e…
1344 The two strands in a DNA double helix get their specificity and thermal stability from…
1345 Which of the following steps is not included when Gram staining bacteria in order to differentiate t…
1346 Of the following rRNA sequences from fictional organisms which sequence is most related to sequence …
1347 Which microscope would work best for observing stained Gram-positive bacteria?…
1348 When watching a micro-organism under a high-resolution microscope, the micro-organism is moving in a…
1349 Which type of bacterial cell (Gram-Positive or Gram-Negative) has a higher success rate in dry envir…
1350 Which of the following is not a difference between DNA and RNA?…
1351 Which bests describes the function of the Neuraminidase enzyme in viruses?…
1352 Provide a reason why DNA is largely used to carry hereditary information instead of RNA.…
1353 Which of the following happens after a virus begins to replicate its genome and viral proteins are e…
1354 Pick the correct pairing describing the run and tumble movement of bacteria who are motile by flagel…
1356 16s rRNA sequencing is often used to construct a phylogenic tree. Below, scientists have isolated se…
1358 The double helical structure of DNA is stabilized by _______ between opposite bases and _______ betw…
1359 A leaf of a tomato plant has a stoma that is 7.5 micrometers wide. Which of the following microorgan…
1360 Which of the following rankings below about the relative size of microscopic beings, is correct?…
1361 Which of the following is a possible limitation of the DNA hybridization method of defining Archaea …
1362 You’ve discovered a new bacterium and you want to observe its chemotactic behavior. What staining an…
1363 Thonis Philipszoon was the first person to observe microorganisms (17th century). However, if it was…
1364 You have recently isolated two bacteria and found that they have 70% DNA-DNA hybridization; can the …
1365 What is the main difference between DNA and RNA according to their pentose sugar structure?…
1367 Which of the following structures could <b>not</b> be used for motility…
1368 Louis Pasteur was a pioneer in the field of microbiology, which of the following discoveries was he …
1369 Which of the following statements is true?…
1371 5’ AUCCACGUACAGAUGGCACUGUUAUGAUGUCAAGACUUCCUG 3’ You translate the above mRNA sequence. How many …
1372 Which is NOT a function of the nucleus in Eukaryotes…
1373 The key difference between viruses and prions is that viruses…
1381 In the sequence 5' UUGUUGUUG... 3' repeating, how many different Amino Acids can be translated? UUG…
1382 What attribute of the DNA double helix allows it to be a stabile structure?…
1383 Which of the following is a problem when defining bacterial and archael species as having more than …
1384 Which of the following organisms is most closely related based on their 16S rRNA sequence? Organism…
1385 Below is the sequence of the template strand of a piece of a gene in some DNA. What would the antic…
1387 Bacteria are unique from Archaea and Eukarya in they ____ and they have membranes lipids that contai…
1390 You recently discovered a new virus that primarily infects UW-Madison students. Based on the knowled…
1391 In order to maintain a ____ surface to volume ratio and a ____ rate of diffusion, most Bacteria are …
1392 Which statement about viruses is false?…
1393 What makes DNA stable?…
1394 What is a biological impact of microbes?…
1395 What do λ and T4 viruses NOT have in common…
1397 What does a Gram-negative bacterium have in its cell wall that Gram-positive bacterium does not?…
1399 What is the correct order of the steps involved in transcription?…
1400 What two structures of Gram-negative cells and what two structures of Gram-positive cells (respectfu…
1401 Chemotaxis involves a _______ movement which is driven by _______.…
1402 A piece of viral genetic information enters into a eukaryotic host cell and migrates to the nucleus.…
1403 What is a possible limitation of the DNA hybridization method of defining Archaeal and Bacterial spe…
1405 You are planning an experiment in which you want to observe how a specific microorganism reacts to c…
1407 Which of the following is NOT true about the cell membrane and wall Gram-negative bacteria?…
1408 In general, microbes tend to be:…
1411 How would a point mutation (a change of a single base pair) in the termination sequence of a gene af…
1414 When people think of bacteria, they often equate it with negative attributes such as causing disease…
1416 You have two vials of subviral entities and are convinced that vial A contains prions and vial B con…
1417 16S rRNA are used when comparing the evolutionary relationship between organisms as the sequence is …
1419 Polyhydroxybutyrate appears in the ______________ and is a way to store ______________…
1420 The key difference between viruses and prions is that viruses…
1421 Which of the following statements below is FALSE?…
1422 A bacterial cell is in a liquid medium while detecting an attractive chemical signal. It is in the o…
1424 A _____ symbolizes a(n)______ on a phylogenetic tree and means the organisms _______closely related…
1425 Your friend wants to engineer a new species and would like to know where the hereditary information …
1426 What makes prions different than viruses?…
1427 What are bacterial cell membranes made of?…
1429 Microbes are measured in _____________ and are able to be penetrated on the _____________.…
1430 Which structure can NOT be seen using a light microscope?…
1431 Choose which of the following statements is NOT true about the nucleoid.…
1432 When certain bacterial cells disintegrate, they leave behind components that can be lethal to mammal…
1433 Which of the following helps explain why glycolysis and the tricarboxylic (Krebs) cycle are so highl…
1436 Which of the following samples would you not be able to image well using a confocal microscope?…
1437 Which of the following is NOT a difference between prions and viruses…
1438 A student wants to view a translucent specimen to get an idea of its size and shape. They used a li…
1439 Given the following mRNA sequence, decode it into a 13 chain of amino acids using the codon table. …
1440 What was Edward Jenner's goal in his research involving milk maids?…
1441 The lack of 2'-OH group in the DNA double helix structure causes all of the following except...…
1442 What was the problem with traditional phylogenetic analysis when it came to bacteria and why was 16s…
1443 Given only the following 16S rRNA sequences, determine what organisms are the most and least related…
1445 Bob believes that the viral infection cycle is Attachment, Entry, Gene expression, Maturation, and R…
1446 What statement about DNA and RNA structure is true?…
1447 You are studying an amoeba and find a membrane protein of particular interest. Where would you likel…
1448 When viewing Gram stained bacteria under a bright-field microscope, you notice some bacteria are sta…
1449 You are studying a completely novel (new) microbe and observe it to have the following characteristi…
1450 A major difference between enveloped viruses and naked viruses is...…
1451 You have created a mutant of <i>E. coli</i> where the protein mutated is completely non-functional. …
1452 In an environment where a microbe must be smaller than 10 μm to evade protozoa attraction, which of …
1455 The chemical modification of a glucose molecule as it is transported across a cell membrane…
1457 What do T4, Q&beta;, and &lamda; viruses have in common ?…
1458 What is a difficulty that DNA viruses can face during replication and gene expression?…
1459 Which of the following is NOT true regarding the evolutionary relatedness of organisms based of phyl…
1463 The first step a lysogenic virus takes to infect a bacterium is attachment via specific recognition …
1464 What is a unique feature of Qβ that neither T4 or λ possess?…
1465 After viral nucleic acid has been replicated, transcribed and translated, what occurs next during vi…
1466 Which of the following statements about bacterial cell structure is not true?…
1468 Why must specimens be stained when using bright-field microscopy?…
1471 Which of the following is NOT a common trait between viruses and prions?…
1473 Why are microbes beneficial to basic research?…
1474 What is a major structural difference between unsaturated and saturated fatty acids that affects the…
1476 A difference between pili and flagella is that…
1477 When bacteria perform chemotaxis, they:…
1479 Which of the following statements about viral polymerase is true?…
1480 In which category of organisms can bacteria exchange DNA via horizontal gene transfer?…
1482 Which of the following statements regarding the structure of DNA and RNA is false?…
1484 Thonis Philipszoon (Antony Van Leeuwenhoek) was able to observe the first bacteria because…
1485 Which of the statements about microorganisms/microbes is/are true?…
1489 In bacteria, all transport systems are driven by:…
1490 When distinguishing between Gram-negative and Gram-positive bacteria, the difference between the two…
1492 Microorganisms have helped humans to discover all EXCEPT?…
1493 In prokaryotic cells, transcription and translation occur on the surface of the nucleoid and also…
1494 Working in a microbiology lab, your supervisor brings you a novel bacterium that needs to be classif…
1495 Which of the following statements is unique in Bacteria.…
1500 Which of the following is a main difference between group translocation and active transport?…
1501 When would a lysogenic virus like bacteriophage λ choose to enter the lytic phase immediately?…
1502 Which type(s) of viral genomic material do not have to bring a polymerase with them?…
1503 Which option correctly pairs the domain of life with a unique characteristic to that domain?…
1504 Microbes exist within both harmful and helpful relationships. Which of the following is/are a benefi…
1505 Every living organism contains an area specific for housing DNA. In which structure will you find th…
1507 In the process of a virus infecting a cell, the virus binds to the cell, invaginates, forms an endos…
1508 You find a small microbe in a stream during your field work. You know the shape but want to have a b…
1509 All the following are true about peptidoglycan except…
1510 This structural unit of prokaryotic cells is an irregularly shaped region that contains all of the g…
1516 Archaea are known for their ability to survive in extreme environments. What component of their cell…
1517 A feature that allows DNA to carry hereditary information rather than RNA is…
1518 A major difference between the cell membranes of bacteria, eukarya and archaea is that…
1519 Why was there a large lag between the work of Thonis Philipszoon and the cultivation and understandi…
1520 The DNA double helix is stabilized by all these forces except for...…
1522 In translation, which is the correct group of three stop codons that tell the cell when the polypept…
1524 What percentage of life on this planet is microbial (By biomass)…
1525 Tom Brock went on a trip to Yellowstone and saw something in the hot springs. This eventually led hi…
1526 One problem in origin of life research is to try to explain how a ribosome, which is mostly protein,…
1527 The protein MreB in bacteria…
1528 If the temperature of the environment that a bacterium is in drops, the membrane becomes…
1529 Which of the following bacteria would be most susceptible to lysozyme or penicillin?…
1531 Which of the following correctly lists the correct location of the periplasmic space?…
1533 You are a new researcher in a microbiology lab. You are working on an experiment to characterize an…
1534 Bacteria, Archaea, and Eukaryotes are the three main domains of the phylogenetic tree. Choose the be…
1535 If you consider all types of viruses (dsDNA, dsRNA, ssDNA, ssRNA) what structure/enzyme is required …
1536 Which type(s) of RNA have a secondary structure?…
1539 Which is NOT a way that bacteria impact our daily lives?…
1542 Is DNA or RNA a better host for hereditary information? Why?…
1543 An infected cell culture is exposed to ultraviolet radiation in hopes of neutralizing any unwanted v…
1544 Which of the following is a possible outcome of a Lambda phage infecting a cell?…
1547 Which of the statements below regarding chemotaxis is false?…
1548 Which of the following is true about phylogenetic trees?…
1549 Which of the following is false about the role of the promoter in transcription?…
1552 What piece of evidence below supports the Endosymbiosis hypothesis?…
1554 Why does saliva act as a defense mechanism against bacterial invaders but doesn&rsquo;t damage the h…
1555 Bacteria, Eukarya, and Archaea have in common these components <b>except</b>…
1556 The following four strands of 16 rRNA sequence were identified from four separate species. Which two…
1557 You have a microbe, <i> Moorella</i> strain AMP, that can grow on formate by converting it to hydrog…
1558 Your colleague is investigating an anaerobic ocean environment where the sulfate is disappearing and…
1559 In the mechanism of ATP synthase, the beta subunits…
1560 Take a look at this metabolic pathway. In the final step, the conversion of acetyl-P to acetate is a…
1561 This pathway shown below is an example of.... <img src="/instr/images/quickcheck/bifido.png" alt="A…
1562 Kombucha tea is fermentation of the sugar added to tea by yeast, acetic acid bacteria, and lactic ac…
1563 Which of the following is true for aerobic respiration but not for anaerobic respiration?…
1564 Your bright, overly energetic, graduate student comes to you with a plan to increase the growth of a…
1565 Looking at the growth rate of <i>L. lactis</i> under aerobic and anaerobic conditions, it appears th…
1566 ATP synthase generates ATP through the proton motive force. As ATP synthase turns, protons fall thro…
1567 A medium is prepared that contains the following ingredients: <table class="table table-striped"> <…
1568 Below are statements about anaerobic respiration and aerobic respiration, which one or ones is FALSE…
1569 Which of the following pathways contain a redox reaction?…
1570 There are two main differences between oxygenic and anoxygenic photophosphorylation, what are they?…
1571 Which of the following are reasons that microbes may have limited growth in an environment?…
1572 The type of metabolic pathway that will produce the maximum yield of ATP will be:…
1573 Microbes ferment many foods for human consumption such as cheese, chocolate, and beer. One way to re…
1574 An isolated mesophilic organism is being cultured in the Microbiology lab at 50&deg;C on a Nutrient …
1575 Which of the following does not increase reaction rate?…
1576 A researcher is considering using the optical density (OD) method for monitoring the growth rate of …
1577 Which of the following statements about iron-sulfur proteins is true?…
1578 Which of the following is true regarding irradiation methods to control microbial growth?…
1579 In the reaction A+B-->C+D, if the concentration of D increases, in what direction will the reaction …
1580 You are attempting to grow some of the bacteria you find in your room and measure its growth. But di…
1581 Bucky wants to enrich his soil sample for <i>Streptomyces</i>. He sterilized the tools that he would…
1582 Why does cooking food minimize microbial growth and keep it from spoiling as fast as it would if it …
1583 All of the following contribute towards the generation of a proton gradient EXCEPT:…
1584 Which of the follow statements about nutrients is FALSE?…
1585 How does light create a proton gradient in retinal-based phototrophy reactions?…
1586 A friend isolated a new bacterium and wants to know if it uses fermentation as its sole source of ge…
1587 Which of the following contain Bacteriochlorophyll as a photo pigment in their light harvesting stuc…
1589 Using the table of electron half reactions, which of the following flow of electrons is correct? <i…
1590 Which of the following are true concerning the difference between substrate-level phosphorylation an…
1591 Which statement regarding fermentation is false?…
1592 How does aerobic respiration differ from anaerobic respiration?…
1593 I am trying to make a food product that contains only lactate as the end product, which type of ferm…
1594 A brewer makes a w&ouml;rt that is high in sugar, however, he has a leak in his fermentation vessel …
1595 Which of the following statements is false regarding oxygenic and anoxygenic photosynthesis?…
1597 You are making cheese at WeSaySo Dairy Corporation. The milk is pasteurized and starter culture is a…
1598 The chlorosome found in green bacteria is analogous to…
1599 If you compare the reaction centers of green, purple, and cyanobacteria, they all have…
1600 Unknown to you, you have purchased meat contaminated with <i>Salmonella enterica</i>. However, you c…
1601 Bacteria that are living in a biofilm have the advantage of ________________ but the disadvantage of…
1602 An electrochemical gradient is required in which of the following processes:…
1603 The macronutrients found in all living cells are:…
1606 Fermentation of kimchee is a 3-step process. What would happen if the third step failed to occur?…
1607 Which of these electron acceptors are NOT used in anaerobic respiration?…
1609 A microbe was growing spectacularly in its environment, but suddenly this growth seems to have come …
1610 Given these two half-reactions, determine which has the most potential energy?<br /> <img alt="The …
1612 Which of these is NOT involved in oxidative phosphorylation?…
1613 A new bacterium is found and it was discovered that it gets its energy from oxidation of organic com…
1614 Organisms with very specific nutritional needs and growth factor requirements are often called fasti…
1615 Which of the following is a key spore structure providing it with resistance to radiation?…
1616 Organisms with very specific nutritional needs and growth factors are often called fastidious; and i…
1617 The shape of an organism (by the shape of its cell wall) is dictated by?…
1618 Which of the following is not a consequence of Binary Fission?…
1620 What would happen if you were to cut off the light source to a bacterium classified as a "chemoautot…
1621 Select the most correct statement when comparing retinal-based phototrophy to generic photosynthetic…
1622 You are doing another boring organic chemistry lab with a chemical reaction that is notorious for ta…
1623 A major difference of cell structure and function in biofilm versus planktonic cells is...…
1625 Which of these food preparation/preservation techniques would <b>not</b> minimize microbial growth d…
1627 Which method(s) is(are) best in controlling microbial growth in food?…
1628 Which of the following values would indicate an organism grows the slowest.…
1629 Which of the following statement is incorrect?…
1630 Which micronutrient stabilizes the ribosome and is needed for ATP-dependent reactions?…
1632 According to electron potential, which compound is most likely to be an electron donor at the beginn…
1634 Which of the following matches the essential element of all microbes with the correct function?…
1636 Which of the following catabolic pathways perform substrate level phosphorylation to synthesize ATP?…
1639 If you sterilized surgical equipment what kind of microbes would you expect to remain?…
1640 You wish to culture some <i>E. coli</i> overnight for an experiment you want to perform tomorrow. Yo…
1641 Which of the following about the flow of electrons in the respiratory chain are false?…
1642 A primary distinction between photosynthesis and retinal-based phototrophy is that photosynthesis de…
1643 You are observing an unknown microorganism that has been incubating at room temperature in thioglyco…
1644 It is discovered that a Gram-negative bacterium has a dysfunctional F<sub>o</sub> Motor Protein when…
1647 Which method of measuring cell number is ideal if you only want living cells?…
1648 What type of organism will be able to live an environment with a decreased amount of water (dry)?…
1649 You are running a very time-sensitive experiment that involves culturing a microbe with a growth rat…
1651 Given the reaction and a table of electron half reactions, why is this a favorable reaction? 2NADP<s…
1652 A bacterium has a respiratory pathway that uses iron as its electron donor and oxygen as its termina…
1653 You are in Micro 304 and must go out in nature to collect a sample for the nature isolate lab. In or…
1654 A researcher in the lab wants to find out whether there are aerobic nitrogen fixers present in a sam…
1655 A certain species of lactic acid bacteria is a chemotrophic aerotolerant anaerobe. It is cultured on…
1656 Glucose + ATP → Glucose-6-P + ADP In this reaction, if you increase amounts of Glucose-6-P and ADP,…
1657 Purple bacteria are...…
1659 Which of the following scenarios describes the growth of planktonic cells?…
1661 Endospore formation is triggered by limited nutrients amidst high cell density. Which of the followi…
1662 Below are the components of an electron transport chain that reduce iron for <em>Bucky wisconsinis</…
1663 When a yeast cell is given sugar in an aerobic environment, what will it do?…
1664 Which of the following best describes how ATP is generated in a photosynthetic bacterium?…
1665 You are growing a series of bacterial cultures for your lab when you notice a potential contaminant …
1666 Which type of fermentation produces more than one product?…
1668 What treatment allows for the extended shelf life of fresh shrimp?…
1670 Which of the following does not accurately describe a way to control microbial growth?…
1672 Water availability is an important factor for growth. <i>Halobacterium salinarum</i> has adapted to …
1673 If cytochrome <i>b/c1</i> were removed from the electron transport chain, the process would lose wha…
1674 Which is incorrect about pasteurization and sterilization?…
1675 Which of the following is/are characteristic of the Light Harvesting Complex (LH Complex) in Green …
1676 Which of the following steps must happen FIRST to pump protons across the membrane?…
1678 All microbes require all of the following for favorable growth except...…
1680 __________ directly phosphorylates ADP into ATP with phosphate and energy provided from a coupled re…
1681 What physical treatment would you use to sterilize a liquid that contains bacteria as well as small …
1682 A microorganism in a harsh environment is having a hard time making stable RNA and DNA despite havin…
1683 Which of the followings is true about substrate level phosphorylation?…
1684 What is the main difference between aerobic respiration and anaerobic respiration?…
1685 Which of the following is a true distinguishing factor regarding the light harvesting centers in pur…
1686 Temperature, being a limitation on growth, exists in many different ranges. What happens to microbes…
1688 After glycolysis, there is an excess amount of NADH. In homofermentation, which molecule does this N…
1689 Which of these is different between substrate level phosphorylation (SLP) and electron transport lev…
1690 Which of the following statements about purple bacteria is true.…
1691 You are trying to isolate cyanobacteria to better understand the problems that lake Mendota is facin…
1692 After running some tests on a newly discovered bacterium, you discover it uses light as an energy so…
1693 Which of the following elements is not needed at concentrations of less than 1%?…
1696 If a novel bacteriophage is discovered that effectively disables the reaction center in light depend…
1698 Which of the following choices is a reason why purple bacteria can be a great model systems for rese…
1704 Which of following statement about Chlorobiaceae, the green sulfur bacteria, is false?…
1705 The following statement on the differences and similarities between retinal-based phototrophy to cla…
1707 Which of the following undergo anoxygenic photosynthesis?…
1708 Which metabolic pathway(s) generate(s) ATP through substrate level phosphorylation?…
1709 You decide to start farming cocoa trees in Wisconsin (great idea), and you somehow get a successful …
1711 Which one of the following explanations best summarizes the relationship between carotenoids and chl…
1712 Which of the following statements regarding chemoheteroorganotrophs is false?…
1713 When comparing biofilm and planktonic cells, which of the following is true?…
1715 Which of the following is not a reason why purple bacteria is such a good model organism?…
1716 Dr. Paustian heats a solution containing microbes to a temperature that kills most but not all of th…
1717 You want a culture of <i>Bacillus subtilis</i> to reach a concentration of 1 x 10<sup>5</sup> by 3 P…
1718 Which of the following problems often encountered during the cheese making process is likely caused …
1719 What mechanism does ATP synthase use to create ATP?…
1720 Chlorophyll and carotenoids in the reaction center have all the following in common EXCEPT...…
1722 Which of the following would be the least likely to act as terminal electron acceptors in anaerobic …
1725 Which of the following is false about retinal based phototrophy?…
1726 You are studying how an obligately anaerobic bacterium will react under stressed conditions. Select …
1727 Fred Griffith's transformation study with rough and smooth cells in <i>Streptococcus pneumoniae</i> …
1728 In <i>E. coli</i> what happens if a mutation in symR antisense RNA cause it to not hybridize to SymE…
1729 In an attempt to mutagenize <i>Xanthobacter autotrophicus</i> a pRL27 plasmid was mated from <i>E. c…
1732 Which is an NOT option you may use to preform a screen to isolate or identify a mutant?…
1733 Oh no! You've accidentally exposed so E. coli to a mutagen that causes section 4 on the mRNA transcr…
1734 In quorum sensing in <em>Staphylococcus aureus</em>, there is a mutation in <em>agrC</em> so that it…
1735 In Griffith's classic experiment of rough and smooth cells, the following situation showed that DNA …
1736 You have a culture of bacteria and you want to find mutant cells that are resistant to an antibiotic…
1737 A lithotroph, such as those that oxidize iron, use which of the following as an electron source?…
1738 Which of the following is true of Griffith’s classic experiment with rough and smooth cells in mice?…
1739 You are attempting to grow a bacterial culture in the lab. You plate the culture on a minimal medium…
1741 Which of the following is NOT an important ecological/physiological function of soil microbes?…
1743 You are conducting a study in an ocean environment. What is an example of a microbe you might encoun…
1744 Which of the following is the most direct reason for fish kills after cyanobacterial blooms?…
1745 The <i>trp</i> operon utilizes repression, attenuation, and feedback inhibition. Which of the follo…
1746 You are analyzing the sequences of two bacteria that you collected from the same soil sample. They s…
1747 If an allosteric effector binds itself to a protein via an allosteric site, what will happen?…
1748 You collect a soil sample, extract DNA, and sequence it. After using an assembler you find a 200 kil…
1749 Consider all the regulatory circuits that control the <i>trp</i> operon when answering this question…
1751 In <i>E. coli</i> you have isolated a mutant CAP (also known as CRP) gene that behaves as if cAMP is…
1752 A <i>Vibrio fischeri</i> strain having a mutation in LuxR such that it no longer can bind AHL (acyl-…
1753 It is possible to accurately predict if a bacterium has sections of its DNA from another bacterium (…
1754 Sorcerer II yielded data on an unidentified organism. The organisms genome contains an ORF for a pro…
1756 What is true about catabolic operon and anabolic operon?…
1758 Which of the following statements are true for plasmids in microbes?…
1759 Which of the following sequence of events correctly describes a CRISPR-Cas mechanism?…
1762 There were TT dimers observed in a patient's DNA strands. It is also fixed by photoreactivation. Wha…
1763 When sequencing the genome of a microbe isolated from the environment, you notice that the microbe c…
1764 You grow ten separate cultures of <i>E. coli</i> overnight. Each of these is plated onto ten plates …
1765 You isolate a new organism from the turf of Camp Randall, <i>Bucky badgerous</i> and sequence its en…
1766 You take the bacterium <i>Bucky badgerous</i> and use CRISPR to knock out xylose catabolism by inser…
1767 Which of the following is not a step in CRISPR gene editing?…
1768 What function does CRISPR serve in bacteria?…
1769 In the Ocean at a depth of 150 meters, select the best option to describe the microbe that lives the…
1770 Working in your universities microbiology lab you are asked to identify a microbial species for your…
1771 Which of the following organisms would be expected to be a primary producer around a deep sea ocean …
1772 If a mutation formed in a strain of <i>E. coli</i> that resulted in complete inactivation of the cat…
1774 You are observing a community of microbes in anaerobic conditions. You observe a large amount of ace…
1775 You take a sample from a lake and discover an Actinobacteria that is producing ATP using ATP synthas…
1776 You cause a mutation to a <i>Vibrio fischeri</i> which deactivates their Luxl activity. A phenotypic…
1777 CRISPR could be a novel new technology in the world of Human Immunodeficiency Virus because it……
1778 What is false about the symbiosis between the tube worm and sulfur oxidizing bacteria?…
1779 Which of the following is true of actinorhodopsin found in acI actinobacteria?…
1781 The scaffolding of cellulose enzymes serves what purpose when degrading cellulose?…
1782 Suppose you have used CRISPR to mutate a microbe to relieve catabolic repression and allow a bacteri…
1785 <i>Vibrio fischeri</i> use autoinduction and quorum sensing in order to produce bio-luminescence. Wh…
1786 After a long hard winter in Wisconsin, Fred, a timber rattlesnake, assesses his DNA. He finds a erra…
1789 Why would a fungus break down wood with free radicals instead of enzymes on the cell surface like th…
1790 A mutation occurs within the allosteric site of the repressor that binds to the tryptophan operon, t…
1791 The recently discovered wiscose operon (wisc) produces catabolic genes that degrade wiscose and has …
1793 Which of the following points of regulation is paired correctly with its mechanism?…
1794 Bacteriorhodopsin provides a huge advantage for Archaea under:…
1795 Which of these microbes lives in the ocean, is a thermophile, and uses Fe<sup>3+</sup> as the termin…
1796 You are given a large amount of <i>Nitrobacter winogradskyi</i> which is a nitrite-oxidizing bacteri…
1797 Griffith used two related strains of <i>Streptococcus pnuemoniae</i>, R and S. When grown....…
1801 You are maintaining a culture in the laboratory that is able to grow on minimal medium containing ma…
1802 A severe mutation causes a strand of anti-sense RNA to be unable to bind to its complementary mRNA t…
1808 Which of the following about cellulose degradation by cellulosomes is false?…
1809 What are the phenotypic consequences of a frameshift mutation in <i>lacZ</i>?…
1810 You&#39;ve isolated a novel bacterial strain and want to understand the makeup of its genome. One me…
1811 Which of the following reasonings are TRUE regarding cyanobacteria growth?…
1812 In a laboratory, you have a sample of <i>Nitrosomonas europea</i> which is an ammonia-oxidizing bact…
1813 What would be the result of a mutation in adenylate cyclase that rendered it completely unfunctional…
1815 Which of the follow is correct regarding primary producers of lakes and deep sea vents?…
1816 Which one of these is NOT a benefit of CRISPR?…
1817 Which of the following statements is <strong>incorrect</strong> about CAS gene functions?…
1818 You expose a strain to a transposon containing bacitracin resistance. Then you plate the resulting c…
1819 You accidentally exposed a culture of bacteria to UV light causing mutations in the DNA. What method…
1820 You suspect a mutation in the lac operon of <i>E. coli</i>, causing it to no longer ferment lactose.…
1821 Cyanobacteria usually increase in growth during the Spring because...…
1826 A major difference between plasmids and chromosomes is that…
1827 The Hawaiian bobtail squid hides its shadow through a _________ relationship with <i>Vibrio fischeri…
1828 You’re a scientist working with a new bacteria, <i>Buckii badgeris</i> that has no plasmids. Trying …
1830 While examining a strand of DNA you stumble upon a dimer between two thymine bases. What do you susp…
1831 If there is a mutation in region 4 so that it can no longer hybridize with region 3 of the <i>trp</i…
1833 Which of the following is/are true regarding bacteriochlorophyll and rhodopsin?…
1834 Anthranilate synthase is a key enzyme in the tryptophan synthesis pathway. Which of the following co…
1835 All of the following are sites of bacterial gene expression EXCEPT:…
1836 A functional difference between a catabolic operon and an anabolic operon is that…
1839 If there were to be a spontaneous mutation in the allosteric site of CAP *(also known as CRP) that i…
1843 It is rare to find mutations in SymR (the antisense RNA that regulates SymE). Why do you think that …
1845 A mutation in DnaK such that it can no longer bind to RpoH (aka σ-32) would result in…
1846 UV light is known to cause pyrimidine dimer mutations within DNA, which is why tanning too much can …
1847 A drug resistance gene transfers from <i>Bacillus cereus</i> to <i>Steptococcus pneumoniae</i>. This…
1852 If there were a mutation in AgrD of <i>S. aureus</i>, such that it does not bind to AgrB, what would…
1854 Which statement is true regarding Fe oxidation in iron-oxidizing microbes and oxidative phosphorylat…
1855 Which is of following are conditions or tests that can be used when selecting to find a desired stra…
1856 <i>Leptospirillum ferrooxidans</i> is the dominant bacterium in the acid mines. It grows by oxidizin…
1857 What of the following properties is true for oligotrophic lakes in comparison to eutrophic lakes?…
1859 When thinking of the role of Cyanobacteria in the lakes (<i>Anabaena</i> sp.) and ocean (<i>Prochlor…
1860 Regarding the carbon cycle, which of the following is true?…
1861 If a spontaneous mutation arose in the Cas9 that inactivate the protein, what would be the result fo…
1862 After a long drought, you examine the soil and want to determine whether or not there are any viable…
1863 All of the following are potential risks of CRISPR except?…
1864 Which of the following is true about the process by which photoautotrophs fix carbon.…
1865 Which of the followings is more likely to cause a thymine dimer mutation?…
1866 Ac1 is a type of actinobacteria found in lakes that uses actinorhodopsin to:…
1867 A mutagen causes part of a genome to undergo a base change, where a cytosine is deaminated leaving u…
1868 Given the major differences between methanotrophs and autotrophs, what is a distinguishing feature t…
1870 Which of the following microbe types would most likely be dominant in an anaerobic, sulfate free env…
1871 Bacterial species such as <i>Flavobacteria</i> increase in number after a Cyanobacteria bloom to deg…
1876 What would be the phenotypic consequence if the AgrC (the protein that binds AIP) in <i>Staphylococc…
1878 Which of the following statements is false when comparing Fe oxidation and oxidative phosphorylation…
1879 How are plasmids are chromosomes different in bacterial cells?…
1880 You've been given the task of altering the DNA sequence of a novel bacteria using CRISPR. What is th…
1881 Researchers have noticed an unusual number of dead fish in Lake Mendota. They test a sample of the l…
1882 The essential difference between a plasmid and a chromosome is:…
1883 Plasmids maintain themselves in their host cell by all of the following except...…
1884 A mutation occurs within the <i>luxI</i> gene of <i>Vibrio fischeri</i>, causing it to no longer fun…
1885 Which of the following species does NOT benefit from a symbiont microbe species that uses N<i>2</i> …
1886 <i>Methylomirabilis oxyfera</i>, a bacterium that uses N-DAMO, uses _____ as an energy source and ge…
1888 Which organism does Cyanobacteria have a nitrogen-fixing partnership with.…
1890 There is a strain of <i>Corynebacterium diphtheriae</i> that seems to be resistant to a multitude of…
1892 One wants to minimize the production of lactose and maximize the production of tryptophan, what is t…
1893 Quorum sensing is advantageous in bacterial cells in all the following ways except...…
1894 Low copy number plasmids rely on the host cell for the following functions...…
1895 Which of the following is/are true about the components of a plasmid…
1896 Which of the following explanations is correct regarding this statement: Brown rot fungi use lignin …
1897 Different species of microbes can share portions of their genomes as well as different individuals w…
1898 During which step of the nitrogen cycle will a facultative anaerobe grow on oxygen if it is availabl…
1899 Which of the following statements regarding Griffith's classic experiment is false?…
1900 You examine a dead deep sea tube worm and determine it died from not having enough organic carbon. W…
1902 Which of the following may contribute to the virulence of a pathogen?…
1903 Which of these would tell you if a microbe has experienced Horizontal Gene Transfer just by using a …
1905 What would happen to a tube worm if it encountered cyanide ( a respiratory poison)?…
1907 Which of the following is not a primary producer at a deep sea ocean vent?…
1910 An E.coli cell is infected by a bacteriophage. The bacterium has CRISPR guide RNA that is able match…
1911 Which of the following is false regarding horizontal gene transfer?…
1913 Which of the following is incorrect regarding rhodopsin and photosynthesis.…
1914 A mutation in the <i>trp</i> operon that causes a deletion of the <i>trpE</i> gene would……
1915 A strain of <i>E. coli</i> has a deletion mutation of <i>malT</i>. If you place the strain in a Rich…
1916 You have found a repressor protein (<i>leuR</i>) that prevents synthesis of leucine in <i>Bucky anon…
1917 Which of the following is not often found on plasmids?…
1918 Which of these microbes involved in the carbon cycle would use methane as a substrate under anaerobi…
1919 You are looking for mutants that are no longer able to synthesize isoleucine. A culture is mutageniz…
1920 Which of the following statements is correct regarding choline and cardiovascular disease (CVD)?…
1921 What is the main reason that vegans fed a steak meal do not have the same TMAO response compared to …
1923 These cells are a part of the adaptive immune system. They produce antibodies that antigens react wi…
1924 The following cell type does not match the description of its function in the body…
1925 All of the following are true regarding <i>Borrelia burgdorferi</i>, a bacterium that causes Lyme's …
1926 Which of the following is false about virulence and virulence factors?…
1928 What is the function of type III secretion systems in <i>E. coli</i>?…
1930 An example of a toxin that causes in an over reaction of the immune system is:…
1931 Suppose a hypothetical medication is being tested for FDA approval. During clinical trials, the medi…
1932 HIV and HPV are similar in that…
1933 Which of the following statement is incorrect?…
1934 Which of the following is false about the inflammation response?…
1936 Which is a strategy pathogens are known to use to survive inside a phagocyte?…
1939 How do cytotoxic T-cells recognize infected cells in order to kill them?…
1942 Which of the following are reactions leading to the killing of a target cell/pathogen can be mediate…
1943 It has been found that mice with an excess of flavonoid-degrading microbes will:…
1944 When considering acetogens and methanogens, one thing they have in common is...…
1945 Methanogens are often at higher concentrations than sulfate reducers in freshwater sediments, while …
1946 The human microbiota helps humans by…
1947 Which statement regarding Human papillomavirus is false?…
1950 What is the best way to treat a severe, but not yet life-threatening case of <i>Clostridium difficil…
1951 Skunks can harbor Leptospira bacteria without showing symptoms of the disease and transmit it to hum…
1952 Which of the following are <b>not</b> ways in which complement kill microbes?…
1953 When considering the oral microbiome, which of the following statements is true.…
1954 A sulfate reducer could form a syntrophic relationship with a purple photosynthetic bacterium that c…
1955 It's the year 2025. A new probiotic firm claims to have formulated a microbiome that if you take it…
1956 Immature T-cells have the potential to react with self-antigens. What of the following mechanisms th…
1960 Given what you know about <i>E. coli</i> and its mode of transmission, how would you reduce its' spr…
1961 After a period of rapid weight loss, which is true?…
1962 The oral microbiota…
1963 Which of the following is true about microbiota in the oral cavity?…
1964 Which statement is false regarding the role of <i>Akkermansia muciniphila</i> in the GI tract?…
1965 Which one of the following body systems are not involved in the immune response?…
1966 Recent research has shown that vegetarians have a one-third lower risk of heart disease than those w…
1967 Phagocytes have oxygen-dependent and oxygen-independent mechanisms to kill engulfed microbes. Which …
1968 Which of the following immune processes is not involved in detecting the presence of a pathogen.…
1969 Hemorrhagic <i>E. coli</i> is found in dairy and beef cattle. They cannot contract the disease. Ther…
1970 Shiga toxin works by…
1971 Which is not a virulence factor of <em>Staphylococcus aureus</em>?…
1973 The Gram-positive pathogen <i>Clostridium difficile</i>…
1974 Would a fecal transplant of the microbiome of a thin individual into an obese individual help them l…
1975 Which is true about monocytes and neutrophils?…
1977 Which correctly matches the shape of the epidemic and its source?…
1978 Which of the following best explains how the complement system is activated…
1979 This virus replicates by having its (+) strand RNA translated into a polyprotein that is then degrad…
1980 Exotoxins have an A:B structure. The B subunit(s) __________, while the A subunit contains the _____…
1981 A characteristic of <i>Borrelia burgdorferi</i> that makes the microbe particularly difficult to dia…
1982 C. difficile is commonly acquired…
1983 A thin moose is seen, isolated from its herd, drinking from a stream in your backyard. Assuming that…
1984 Lyme disease is unique as it uses a microbe that can_____ which is important in its_____…
1985 WHich of the following is not true for <i>Clostridium difficle</i>?…
1987 Which of the following would be the most effective quarantine protocol?…
1988 What is the primary reason we do not commonly see malaria outbreaks in the United States?…
1989 You've just come home from your best friend Tim's holiday dinner party when you start to feel a litt…
1990 What is the KEY difference between exotoxins and endotoxins?…
1992 Which of the following distinguishes influenza’s replication from that of the HIV virus (human immun…
1993 Neurotoxins are an example of _____ , many of which are proteins that are normally _____ by pathogen…
1995 How does the influenza virus copy its genome and disguise it as mRNA for translation in a host cell?…
1997 A boy named Zack is infected with a pathogenic strain of Bucus badgeritis. The bacteria have made it…
1998 How does human papillomavirus cause cancer?…
1999 What are ways pathogens evade defenses of the Innate Immune System?…
2000 Leukocidin is:…
2001 Which of the following is NOT a way that pathogens are directly transmitted from person-to-person?…
2002 Which of the following are cells/receptors involved in HIV pathogenesis? I. CD4 receptor II. CD4 e…
2003 Which of the following is NOT a method of disease transmission from human to human…
2004 _________ is an exotoxin that causes damage by _________.…
2005 Lethality of endotoxins is due to…
2006 Where do phagocytes originate?…
2008 Which of the following statements regarding the presence of <i>Akkermansia muciniphila</i> in the an…
2009 Invading cells "hide" from the immune system by...…
2010 Which of the following is FALSE regarding human papillomavirus (HPV)?…
2016 The main job of phagocytes in the human body is to…
2018 Which of the following is true regarding the AB Shiga toxin of Enterohemorrhagic <i>E. coli</i>?…
2020 Which of the following cell types do NOT have MHC II molecules (are NOT antigen presenting cells)?…
2023 Which of the following is NOT a way in which the body is able to recognize and/or respond to a patho…
2025 According to the Gleam experiment (an infection simulation modeler), how is the spread of a disease …
2026 True or False: Using a GLEAM simulation map, completely restricting travel of patients showing sympt…
2028 Why does only limiting travel for symptomatic people have a negligible effect on disease spread?…
2031 Complications resulting from an EHEC infection (Hemolytic Uremic Syndrome - HUS) can cause…
2033 You got ill from eating at your favorite restaurant. How do you suspect the pathogen causing your sy…
2034 A new microbe, <i>Howardicia sternius</i>, is responsible for a recently discovered disease. Assumin…
2035 Which type of toxin is in the outer membrane of the cell wall and is usually only a problem when the…
2036 Which of the following is not one of the ways that the body detects the presence of a foreign antige…
2037 When observing a Gleam Map, how does Quarantine affect the spread of an infectious disease?…
2038 What is a difference between a neutrophil and monocyte?…
2039 Which of the following statements is false regarding pathogens?…
2040 Which of the following steps of disease often lead to transmission to a new host?…
2041 How is the metabolic role of microbes for humans similar to the metabolic role of microbes for rumin…
2042 Stopping all travel will do what to an epidemic?…
2046 Which of the following statements about Malaria is true?…
2047 In malaria…
2048 Which of the followings about endotoxin and exotoxin is true?…
2049 Which of the following situations would NOT be satisfied by Koch's postulates?…
2050 When considering phagocytes...…
2051 HIV infections can be treated with…
2052 Preventing the spread of <i>Clostridium difficile</i> can best be achieved by…
2053 The HPV can be mitigated by…
2054 <i>Borrelia burgdorferi</i> is…
2055 Consider HIV, Rhinovirus, HPV, and Influenza virus, HIV is unique in that.…
2056 β-lactam antibotics inihibit______________, fluoroquinolones stop __________________, and macrolide …
2057 Vaccines that are in use today to prevent infection are…
2058 We are seeing a rise in vaccine-preventable diseases because…
2059 What best describes the Staphylococcus food poisoning life cycle?…
2060 Which of the following is considered an exotoxin?…
2062 Which is <strong>not</strong> an example of mutualistic symbiosis between host and microbiota?…
2063 Which of the following is NOT true regarding the Chlamydia life cycle?…
2064 You just started your position at a microbiology lab focusing on the human microbiome. You are helpi…
2065 A student was admitted into the hospital for an unknown illness. The student experienced fever, abdo…
2067 In mice fed labeled dietary choline, labeled TMAO…
2069 A patient receives a kidney transplant after experiencing renal failure. This individual is released…
2070 Which of the following statements is false when defining a disease?…
2071 Which of these macromolecules would be the weakest antigen?…
2072 Which of the following regarding inflammation is FALSE?…
2073 Which of these is NOT an example of a virulence factor?…
2074 HPV is a virus that causes cancer in humans. Why does HPV cause cancer and many other viruses, such …
2075 If a person suddenly faced a loss of their microbiota inside and outside of their body, what would r…
2076 What is the difference and relationship between reservoirs and carriers?…
2077 The beneficial functions of <i>Staphylococcus epidermis</i>, part of the human microbiota, consist a…
2078 Chlamydia trachomatis affects all of the following areas except for _________.…
2080 Which is not involved with the pathogenesis of EHEC?…
2082 Which situation is an example of syntrophy?…
2083 Which step must occur for the body to kill host cells infected with Chlamydia?…
2084 When combating an epidemic, quarantine is:…
2085 Which of the following mechanisms are not used by T-cells or Antibodies to kill?…
2089 Which of the following type of vaccines utilizes parts (proteins, sugars, etc.) of a virus to grant …
2091 Which of the following is false regarding disease?…
2092 You work for the Wisconsin Department of Natural Resources and you are attempting to prevent Chronic…
2095 You work for the Wisconsin Department of Natural Resources and you are attempting to prevent Chronic…
2096 All of the following are ways pathogens evade the immune system EXPECT…
2097 Which of the following is true regarding carriers and reservoirs?…
2098 Which condition will produce the most atherosclerosis?…
2100 Which accurately represents a reservoir?…
2102 All of the following contribute to immunity, except?…
2103 You have a discovered a deadly, rapidly-spreading new virus in the melting glaciers that you call Pa…
2104 Which of the following cell types is NOT recruited in the inflammatory response?…
2105 Imagine you are a doctor working a small clinic. A young woman comes in with a high fever, multiple …
2108 Prior to the attack from a cytotoxic T cell, we need a signal that activates the T cell. Which of th…
2109 Which of the following ways would be the best way to stop the transmission of a prion-caused disease…
2111 True or False: Completely restricting travel of everyone, without any exceptions, in the affected ar…
2112 Which organ/tissue is NOT part of the secondary (peripheral) immune system?…
2113 Which of the following is NOT a metabolic trait that is shared between methanogenisis and acetogenes…
2114 <i>Akkermansia muciniphila</i> is…
2115 Fomites are an important aspect of pathogen transmission, which of the following is true about fomit…
2116 Fomites..…
2117 As a member of the CDC, news that several cases of measles have appeared within a city strike up a m…
2118 Mechanisms of pathogenesis of lyme disease include the following EXCEPT...…
2121 In what ways could a human be affected if all microbes were removed from their body?…
2122 At what stage would the highest amount of endotoxin be released?…
2123 Which is true regarding malaria?…
2124 A diet rich in phosphatidylcholine induces the risk of atherosclerosis.…
2125 A viral disease has emerged and infected a large portion of Madison. Due to commerce limitations tot…
2127 You are working in a laboratory that is trying to culture sulfate-reducing bacteria, from a sample c…
2128 You work as a microbiologist for the CDC. Your boss gives you a potentially disease causing microbe …
2129 How does <i>E. coli</i> attach and remain in the body?…
2131 Adam likes to hunt around the area of Southern Wisconsin. He is disappointed because some of the dee…
2133 The Human Immunodeficiency Virus (HIV) is a retrovirus. What is special about these viruses?…
2134 All of the following are true about <i>C. difficile</i>, except:…
2136 A study in mice is being conducted in which the microbiome of a thin mouse eating normal chow is tra…
2137 Which of the following is false regarding the microbiota of the gastrointestinal tract and the oral …
2139 Which of the following is FALSE about endotoxins and exotoxins?…
2142 HIV is a disease that can leave the host susceptible to ____…
2143 How does the type III secretion system (T3SS) enable Enterohemorrhagic E. coli (EHEC) to translocate…
2144 Shiga toxin, an example of an exotoxin, causes damage to the host by…
2145 Which of the following differences between humans and ruminant animals concerning their metabolic fu…
2146 Which of the following is NOT a way that environmental pathogens are transmitted?…
2147 This type of antibody is the first formed in a primary response and has a pentavalent structure (fiv…
2148 Of the following factors which one could slow the growth of a bacterium in a culture that is an acid…
2149 If you compare Bacteria, Archaea, and Eukarya a distinguishing characteristic of Eukarya is...…
2151 You are designing a new mesh to be placed on wounds. It works by blocking penetration by microbes. W…
2152 Understanding microbiology is important to society because (check all that apply)…
2154 Angelina Hesse learned how to keep substances solid from a neighbor when she lived in New York with …
2155 Louis Pasteur was researching what problem when he proposed the germ theory of disease?…
2156 Which of the following is a reason that the 16S rRNA sequence is useful in comparing the evolutionar…
2157 A mutation in an enzyme only allows a bacteria to make unsaturated fatty acids for the cell membrane…
2158 Observation of a bacterium on a solid surface shows that it is capable of motility. However, electro…
2159 You are on your way to your microbiology class when you trip and fall. The cut from your fall is 0.5…
2160 A researcher separated the chromosome from a non-membrane bound region in a prokaryote cell. What pa…
2161 Which function accurately matches the structure for all bacteria?…
2162 If you compare the structure of the Archaea cell membrane and cell wall to that of a Gram-positive B…
2163 Which of the following is not a type of motility found in bacteria?…
2165 Which of the following is/are true about Archaea?…
2166 Amidst the vast variability of viruses what structure can be found in nearly every virus?…
2168 The type of cellular transport that requires energy and facilitates movement against a concentration…
2171 Which of the following is not a mode of motility?…
2172 How is the function of type IV pili unique from that of both type I pili and flagella?…
2174 The major difference among the cell walls and cell membranes of Bacteria, Archaea, and Eukarya are…
2175 Egg whites have bacteria-fighting properties in them, such as lysozyme. This works by…
2176 Which of the following steps does NOT occur in all viral infections?…
2177 Which cellular transport system uses PEP(phosphotransferase) to get its energy in order to function?…
2178 The structure of peptidoglycan is best described as which of the following:…
2179 Which of the following bacterial cell types (Gram-Positive or Gram-negative) correctly matches the u…
2180 Consider the composition of cell membranes and cell walls of Bacteria, Archaea, and Eukaryotes. Whic…
2183 One basic building block of cells are lipids. Which of the following is a distinguishing characteris…
2184 Which of the following is NOT a mode of motility?…
2185 N-acetyl muramic acid and N-acetylglucosamine form an important structure for bacteria. Which of the…
2187 mRNA is one type of RNA. It is produced from the template strand in the ______ direction. In eukaryo…
2189 The term "microbe" describes a diverse array of organisms, but which of the following is the most ac…
2190 What does the conservation of glycolysis in living cells tell us about their phylogeny?…
2191 When comparing enzymes brought by Retroviruses and DNA viruses,…
2192 Which of the following is created by the misfolding of proteins in neurons?…
2193 Which of the following microscopes do not require you to stain the organisms in order to see them un…
2194 While reading a phylogenetic tree, you notice three descendants sprouting from a single node. This r…
2195 Both lipids and carbohydrates can be used as a form of energy storage within the cell. What are the …
2196 You have a 1 μm cut on your skin that has been infected. Which of the following microbe(s) could hav…
2198 Which bacteriophage(s) contain double-stranded DNA and can go thought a lytic cycle?…
2199 Which is a reason why staining is used in bright-field microscopy?…
2200 What are the major properties of agar that make it a better medium than gelatin?…
2202 A similarity between Gram positive and Gram negative bacterial cells is...…
2203 If you could not Gram stain a cell what kind of microscopy could you use in order to determine if a …
2204 A major difference between the cytoplasm of a bacteria cell and an Eukaryotic cell is that…
2205 In a bacteria cell, which of the following would increase the transcription of a gene?…
2206 At what stage in the virus life cycle does the virus insert its genetic material into the host?…
2207 Which organisms use ester-linked lipids in their cell membranes?…
2209 How is the work of Louis Pasteur and Robert Koch connected?…
2210 In DNA replication across the domains, What is the typical chromosome topology for Bacteria, Archaea…
2213 Which of the following is true about the Gram positive and Gram negative cell envelopes?…
2215 Which TWO structures can be found in both Gram-positive and Gram-negative bacteria?…
2216 <table class="table table-striped"> <tbody> <tr class="table_header"> <td>&nbsp;</td> <…
2217 If you were looking for another molecule besides the 16S rRNA gene to do phylogenetic classification…
2218 Surface layers…
2219 A mutation that completely inactivated one of the genes in the isoprene biosynthesis pathway would b…
2220 An aquatic bacterium may have a gas vesicle…
2221 In Gram-negative cells, transport proteins are found in the cytoplasmic membrane, but not in the out…
2223 The theory of endosymbiosis is supported by evidence that mitochondria and chloroplasts…
2224 DNA takes its double-helix shape due to ___________ and is stabilized by ________________.…
2225 The T4 virus is able to inject their genome into E. coli through what structure?…
2226 A new virus was discovered, upon further analysis it is found that it moves towards membrane envelop…
2228 Which of the following best describes the bacterial phylogenetic group, cyanobacteria?…
2230 The polar chemotaxis clusters function would best be described as (in a bacterial cell):…
2231 Which of the following microbes were most essential to the evolution of eukaryotes and subsequently …
2232 What structural aspect differentiates Gram-Positive and Gram-Negative Cells in a Gram test?…
2233 A researcher has discovered a new virus, but in order to access the genome for sequencing it require…
2234 Why was there a gap between when Thonis Philipszoon discovered microbes and when microbiology became…
2235 Which of the following is a correct description of agar?…
2237 One of the reasons DNA is used to store genetic information because it is less susceptible to what t…
2238 Microbes have a large impact on the environment. Which of the following is NOT a biological process …
2239 After a negative single-stranded RNA strand penetrates a host cell, what is the next step in its vir…
2240 Which of the following statements are true regarding prions?…
2241 A bacterium comes into contact with a negative chemical stimulus. In which way will its flagella rot…
2242 Which of the following is defined correctly and is unique to Gram Negative bacteria?…
2243 A new bacteria has been isolated and you are interested in viewing and studying the compartmentaliza…
2244 Phylogenetic trees inform us relationship between species. According to the phylogenetic tree of Euk…
2245 What is the function of FtsZ in a bacterial cell?…
2246 You believe that a new bacteria you discovered uses pili for movement. You want to use a microscope …
2247 You want to develop a new drug against HIV. What HIV protein would be a good target for this drug an…
2248 What would be the correct way to compare and contrast the cell membrane and cell wall of Bacteria, A…
2251 In ABC transport, what provides the energy that enables movement through the transport channel?…
2252 Which characteristic and description correctly matches their phylogenetic group in Archaea?…
2253 The repeatable two-dimensional crystalline structure found in many Bacteria and Archaea, but is not …
2254 Which of the following suggests mitochondria evolved from proteobacteria and chloroplasts evolved fr…
2255 Which of the following correctly matches the scientist to one of their major scientific contribution…
2256 When does the λ virus make the decision to become Lytic?…
2257 Which of these statements is best explains why 16S rRNA is a useful when comparing evolutionary rela…
2258 From the Domains of the phylogenetic tree of life _______________ are most similar in cell structure…
2259 You are working in a laboratory and discover a never before identified microorganism. After a prelim…
2260 Which of the following describes an accurate comparison of Gram-positive and Gram-negative cells?…
2262 A major reason why RNA is not used for genetic information is there is …
2264 A mutation in a bacterial cell's offspring has damaged and ultimately destroyed the cell's Type IV p…
2266 One of the differences between ABC transporter and group translocation is that?…
2269 A notable difference between the cell walls of Gram-negative and Gram-positive is that…
2270 The discovery of extreme thermophiles in Yellowstone, specifically the <i>Thermus aquaticus</i>, has…
2271 Which of the following phages can be translated right away when it enters a host?…
2272 What type of microscopy and sample preparation would be best for a researcher who wishes to visualiz…
2276 What are two most related organisms?…
2282 Which of the following characteristics are similar across prions and viruses?…
2283 Using the chart below, decode the following mRNA sequence into a 10 amino acid polypeptide. TTTTCUCT…
2287 <em>Myxococcus xanthus</em> is a Gram-negative, rod-shaped bacterium and is able to move using a met…
2288 The structure of DNA is crucial to successfully store information. Which of the following statements…
2289 Why are glycolysis and the Krebs cycle highly conserved in living cells?…
2291 Which of the following structures found in both Gram-negative and Gram-positive cells are matched wi…
2292 <img src="https://www.digitalatlasofancientlife.org/wp-content/uploads/2019/05/AnimalPhylogeny-Topol…
2293 Give an example of a phylogenetic group in the Archaea. List one distinguishing characteristic.…
2296 Which of the following is unique to gram positive cells and is responsible for making the cell wall …
2298 Which of the following statements about transcription initiation in bacteria is incorrect?…
2299 Which of the following best summarizes the evidence that mitochondria and chloroplasts evolved from …
2300 Given the following 16S rRna sequences, determine which two of the following sequences are most clos…
2302 What are the benefits of microbes in respect to agriculture?…
2304 How is rho-dependent termination different from rho-independent termination?…
2305 Which of the following is true about the ways microbes impact human lives?…
2306 Infectious particles that cause diseases such as Mad Cow Disease are...…
2307 When Gram staining bacteria, the crystal violet-iodine complex is retained primarily due to which st…
2308 A major difference between the composition of the lipid bilayer and permeability is that…
2309 You notice a bacteria moving around using an appendage. There is only one appendage and you notice a…
2310 The Anitcodon is presented to make the codon, which structure(s) are involved in this process?…
2311 <i>Lactococcus lactis</i> is a aertolerant anaerobe grows by fermentation. In the absence of oxygen,…
2312 Iron is an essential nutrient. In cells it is often involved in…
2313 Which of the following best describes the growth conditions required for purple bacteria?…
2316 Which of the following is NOT true for anoxygenic photosynthesis?…
2317 This protein complex is responsible for using the energy of photons to excite an electron in a magne…
2318 You need to measure the growth of a bacterium when it is in mid-log phase. It grows by binary fissio…
2319 Below is a recipe for a medium.</p> <p>&nbsp;</p> <table class="table table-striped"> <tbody…
2320 You increase the self-life of a Big Hearty Durian (a type of fruit) and do not want to alter the fla…
2322 A major difference between aerobic and anaerobic respiration is:…
2323 The catabolic maltose operon …
2324 A major difference of the cell structure and function between biofilms and planktonic cells is…
2325 Which of the following is a true statement about the difference between Retinal-based phototrophy an…
2326 Which of these environments would a bacterium that produces siderophores have an advantage?…
2327 In the data below which microbe has the higher growth rate and what is its approximate generation ti…
2328 Which of the following is an element of substrate-level phosphorylation?…
2330 You want to prepare milk for yogurt production. Which heat treatment would probably be the most usef…
2331 How do electrons flow through a respiratory chain?…
2332 A single cell of <i>Pseudomonas aeruginosa</i> settles down on a cell surface. What regulatory syste…
2333 Which of the following is used for classic photosynthetic light reactions but NOT necessary for reti…
2335 A major difference between retinal-based phototrophy(RBP) and classic photosynthesis is that…
2336 Tryptophan regulates its own synthesis in the <em>trp</em> operon by... (select all that are true)…
2337 The activities that are found in two-component systems are…
2338 Green bacteria and Cyanobacteria have similar light-harvesting (LH) complexes. What are some differe…
2340 The <i>lac</i> repressor protein controls expression of the lac operon by:…
2342 Which of the physical agents can reduce the microbial load in beer?…
2343 A discovered strain of <i>Vibrio fischeri</i> requires a higher cell population in order to biolumin…
2344 MacConkey Agar contains ingredients including neutral red and crystal violet and is used for the iso…
2345 A mutation that prevents DnaK from degrading the RpoH protein would…
2346 If there was a mutation in rpoH, so that its secondary structure did not melt at higher temperatures…
2348 You are looking to increase the shelf life of the oranges you just picked. What type of sterilizati…
2349 A major difference between sterilization and pasteurization is that…
2350 One milk sample was pasteurized and the another milk sample was sterilized in an autoclave. What is …
2353 A microorganism uses photosynthesis as a way to synthesize food for itself. It’s method of photophos…
2355 Which of the following includes the essential elements for microbes?…
2356 Which of the following causes protons to be pumped across the membrane during oxidative phosphorylat…
2357 Of the following responses which would be most beneficial to a cyanobacteria in an environment with …
2360 The lactose operon produces catabolic genes that degrade lactose and has a <i>lac</i> repressor prot…
2361 In <i>S. aureus</i> quorum sensing, a mutation in the histidine kinase sensor making it unable to ph…
2362 The binding at an allosteric site on an allosteric protein will result in:…
2363 In simple terms, photosynthesis is known as the process of turning light energy into the products AT…
2365 The impact to all microorganisms from lack of ability to get elements Carbon and Nitrogen into the c…
2366 Which of the following is NOT a role/function of Fe or Mg in enzymatic reactions?…
2367 You discover a new species of bacteria that uses organic compounds as both a carbon source and as an…
2369 I am running a business that sells milk in glass containers. What should my protocol be for controll…
2371 Scientists are studying a certain bacterium, which they have found to be a facultative anaerobe that…
2374 What is the growth rate of a bacterium if, at hour 5, it has 3.48E+07 CFU/ml and at hour 8, it has 2…
2378 The following carriers given are part of an electron transport chain. Given their reduction potentia…
2380 You have a culture of an aerobic halophile that you wish to maintain at its current population size.…
2381 A similarity between the Light-Harvesting Complexes of purple and green bacteria that differs in cya…
2382 A mutation occurs in the Quorum sensing regulation pathway of <i>Vibrio fischeri</i> in which the ac…
2383 Describe this reaction: O<sub>2</sub> + 4H<sup>+</sup> +4e<sup>-</sup> -> H<sub>2</sub>O…
2384 Rachel is in a food science lab and must design an experiment in which she uses ionizing radiation t…
2385 A deletion mutation occurs in <i>trpR</i> so that the tryptophan repressor is always bound to trypto…
2386 Which of the following does NOT happen in negative regulation when an inducer binds to the repressor…
2387 Which form of radiation is used more for prevention of microbial growth in food, and why?…
2389 Which of the following descriptions about the proton motive force and ATP synthase is INCORRECT?…
2390 A beer brewer adds more sugar than normal during fermentation and notices that the end product has a…
2391 Why are cells more likely to survive when subjected to low temperatures versus extreme high temperat…
2392 What happens if the <i>lac</i> repressor doesn't bind to allolactose?…
2393 A strong biocide kills most, but not all, microbes on a glass surface. What method of control is thi…
2395 The major differences between negative and positive regulation of gene expression in microorganisms …
2397 Which of the following statements is true in terms of physical methods for microbial growth control?…
2398 If there is a deletion mutation in the <i>malT</i> gene in the maltose operon, what would be the phe…
2401 As a result, a cell produces a net 2 ATP instead of 1 ATP. Which glycolytic pathway did the cell und…
2403 A microbiologist went out to some acid mine drainage to see if there were any organisms living in th…
2404 The binding of maltose to the MaIT protein recruits which enzyme?…
2405 A microbiologist is studying an organism that uses light to make their energy, uses carbon dioxide, …
2406 A mutation is observed in the region of the adenine efflux pump gene (ydhL) that inhibits adenine fr…
2407 Which of the following would occur if maltose was blocked from binding to the maltose activator prot…
2410 In <i>Vibrio fisheri</i>, which of the following would most directly result in reduced synthesis of …
2411 In Lactic Acid Fermentation, there is an oxidation of ________ to form NAD<sup>+</sup> and a reducti…
2412 When preparing milk that is meant to be refrigerated, which method of antimicrobial control would be…
2413 Redox reactions are happening in abundance in cells. Which of the following is an example of an oxid…
2414 If an antisense RNA somehow was switched from cis to trans, how would this affect the mRNA?…
2415 <i>Euprymna scolopes</i>, a Hawaiian squid species, will uptake <i>Vibrio fischeri</i> only when...…
2416 If an organism prefers to grow and survive at cold temperatures, which of the following best describ…
2419 While isolating a specific bacteria species, you decide to add an antibiotic to the media. What type…
2421 The difference between a chemoautotroph and a chemoheterotroph is that…
2424 If antisense RNA binds to its target ______ less strongly, ______ will be inhibited less, and the pr…
2426 Which of the following fermented food requires the most complicated fermentation process?…
2427 What kind of metabolic pathway would a cyanobacteria undergo given normal light and nutrient conditi…
2428 Which statement about biofilms and planktonic cell is correct?…
2429 An microbe is placed in an environment in which the hydrogen ion concentration is very high and disp…
2430 What is <b>not</b> a unique component of the light-harvesting centers in green bacteria?…
2431 In catabolite repression, a IlA-Glc is phospohorylated due to a lack of glucose which allows adenyla…
2432 You identify Cyanobacteria in a cell culture. After performing some experiments, you find that the C…
2433 What would happen to transcription levels in the lac operon if allolactose could no longer bind to L…
2434 Which of these is specific to planktonic growth that is not specific to biofilms?…
2435 Which of the following growing conditions will not slow down the growth rate of Psychrophiles?…
2436 A scientist is trying to kill endospores in a petri dish. What is the only effective way to do so?…
2437 You want to make a big batch of apple juice at home so you can sell it at your local farmers&#39; ma…
2439 A major difference between micronutrients and trace elements is...…
2441 Fermentation is an energy producing process where…
2444 If a mutation in the <em>rpoH</em> gene caused increased stability of the secondary structure of the…
2447 A new bacterium has just been isolated. <em>Homangi funkii.</em> It was determined to have four circ…
2448 High copy number plasmids maintain themselves by...…
2449 A strand of DNA has the following mutation: <img src="/instr/images/quickcheck/T-T-dimer.png" /> W…
2450 What is the main difference between chromosomes and plasmids?…
2451 A true statement about microbes and their key processes in the nitrogen cycle is that&nbsp;…
2453 Several types of bacteria live on our skin and inside our mouths, noses and throats - in exchange fo…
2455 Which of the following is NOT a feature we would find in&nbsp;a plasmid?…
2457 How do anaerobic bacteria benefit from the production of cellulosomes?…
2458 In a community that contains sulfate ions, microbes will degrade polymers like cellulose, chitin, an…
2459 Both the oral cavity and the gastrointestinal tract are home to a variety of different microbial spe…
2461 There are many functions provided by symbiotic microbes to their host. Match one of these functions …
2463 What repair system would fix a mutation with pyrimidine dimers which was caused by exposure to UV li…
2464 When comparing the respiratory chain of an iron-oxidizing microbe to that of a typical microbe, whic…
2466 You are trying to classify a species. The phenotypic tests show the bacterium is able to ferment lac…
2467 You want to find a heat-stable amylase enzyme for your candy company. You have a new thermophile, <e…
2468 Where would you place <em>Phanerochaete chrysosporium</em> in a community physiology diagram?…
2469 You want to examine the structure of an acid mine biofilm and determine the quantity and location of…
2471 White rot fungi use lignin peroxidase to...…
2472 What would happen to a cow's nutrition levels if its diet was changed from hay and grass to fresh fr…
2473 For a wild type bacterium that uses lactose as an energy source, which of the following would NOT ac…
2474 How are transformation and transduction similar?…
2475 The ________ component of the CRISPR system has the potential to be hazardous because &nbsp;________…
2476 A unique feature of the oral cavity compared to the rest of the GI tract is...…
2477 Which of the following ocean-dwelling bacteria gain at least part of their energy from sunlight? Sel…
2479 How would a human be harmed if all of the&nbsp;microbes were removed?…
2480 Which of the following correctly identifies a microbe and its physiological role in a <strong>lake</…
2481 One difference in an iron-oxidizing microbe in an acid mine versus a typical microbe is that...…
2482 Which of the following is true regarding the steps in energy production by the bacteria in tube worm…
2484 You investigate an anaerobic sample with high concentrations of carbon dioxide and hydrogen and low …
2485 You are tending to your garden and you decide to add compost.&nbsp; Your compost is made up of every…
2486 Which of the following is a correct comparison between&nbsp;methanogens and acetogens?&nbsp;…
2487 The example of syntrophy we looked at in class involved converting&nbsp;…
2490 You are studying a microbe capable of metabolizing lactose, but a new colony is suddenly unable to d…
2491 Which of the following is true in both mechanisms of photosynthesis and bacteriorhodopsin?…
2492 What energy is available&nbsp;for organisms in the deep sea versus for primary producers in a lake?…
2493 Aphids, which are sap-sucking insects, will have symbionts in bacteriocytes. The Beewolf digger wasp…
2494 Humans with severe combined immunodeficiency have ineffective immune systems. They must live in ster…
2496 Although they are in very different environments, what is similar between primary producers at deep …
2497 Trimethylamine oxide (TMAO) is directly related to the intake of phosphatidylcholine by an animal, l…
2498 If you compare the microbiota of a cow and a human, you will find that…
2499 A thin person eats a diet rich in fruits and vegetables. An obese friend consumes a high-fat diet. A…
2500 If you take the microbiome of a depressed human and transplant it into a mouse, the mouse will…
2501 Which cellulose degradation&nbsp;system is the most efficient, and why?…
2502 Sap-sucking or blood-sucking insects and their relationship to microbes differ from Beewolf digger w…
2503 You want to select for <em>Escherichia coli</em> which you know has a pink gram stain. Which selecti…
2505 When considering a syntrophic culture of&nbsp;<em>Syntrophomonas</em>, what acts as the producer and…
2506 Which of the following components are commonly found in plasmids?…
2507 Which of the following is NOT a similarity between the respiratory chain of an iron-oxidizing microb…
2508 What is/are potential benefit(s) of CRISPR system?&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;…
2509 <em>Akkermansia muciniphila</em> is a part of the GI tract microbiome. In a person with a GI disease…
2512 How do Bacteria and Eukarya differ in using the CRISPR/CAS9 system for repair?…
2513 Transduction, transformation, and conjugation are all types of _______. However, ________ requires c…
2514 <em>Bathymodiolus</em> mussels have a symbiotic relationship with the sulfide-oxidizing and methane-…
2515 Which of the following traits do both microbial chromosomes and plasmids share?…
2518 Thinking back to <em>Vibrio fischeri</em> and the Hawaiian squid, what kind of symbiosis best descri…
2519 You are taking a survey of the oral microbiota of several patients at a dentist. You are interested …
2522 In the spring of 2018, histopathological investigations revealed damage to the gills, digestive trac…
2524 You are a scientist and you want to explore the microbiome. You collect ten people and take a sample…
2527 If all microbes were removed from the human body, which function would NOT be affected?…
2528 The iron-oxidizing microbe shares common aspects with the oxidative phosphorylation system in what w…
2530 Which of the following is a correct statement about the nitrogen cycle?…
2532 Which of the following horizontal gene transfers involves a bacterial cell picking up naked DNA from…
2534 If you wanted to test if a mouse had anxiety, what is the correct match between the type of test and…
2535 A decrease in consumption of cheese and dairy (phosphatidylcholine) has which effect?…
2536 Which of the following is a true statement regarding the tests conducted on mice to measure depressi…
2537 A cow suddenly changes its diet so it no longer eats any plant material. What happens to its nutriti…
2538 Which of the following is false regarding plasmids and how they work within their host cell?…
2539 The Griffiths experiment demonstrated that...…
2540 How do cellulosomes contribute to cellulose degradation?…
2542 When comparing metabolic microbes in humans to those in ruminant animals...…
2543 An error occurred where pyrimidine dimers are formed. Which of the following likely caused this muta…
2544 A bacterium (<em>Mikus leckronicus</em>) is isolated from the mouth of a Badger, particularly in moi…
2545 Which of the following would NOT contribute to a cyanobacteria bloom in a lake?…
2547 The relationship between mites that live from eating dead skin and the humans they live on who do no…
2548 If one wanted to clone a gene that would give a bacteria antibacterial resistance, a given ______ wo…
2549 If a mutation occurred in the gene encoding rhodopsin in all bacteria (i.e. bacteriorhodopsin) prese…
2551 How does the presence of a methanogen help&nbsp;<em>Syntrophomonas?</em>…
2552 A plasmid most likely has this type of DNA…
2554 Methanogens and Acetogens compete for CO<sub>2</sub> and H<sub>2</sub>. Which of the following is co…
2556 <em>Bathymodiolus </em>mussels are commonly found near hydrothermal vents on the ocean floor. Which …
2558 All are true regarding the CRISPR mechanism except..…
2559 Acetate, propionate, and butyrate are all products of the microbial fermentation that take place in …
2561 You want to design an experiment to clone a target gene and produce proteins. Which of the steps giv…
2562 Which of the following sets of microbe, substrate, and product&nbsp;combinations are correct for the…
2563 Researchers just discovered &quot;plasmid X&quot;, which is found in the genome of <em>Badgercoccus …
2565 Which of the following best describes the relationships between the photosynthetic process used by p…
2568 You want to study a type of <em>Pelagibacter</em>&nbsp;living in the ocean and its metabolism, espec…
2569 Why do fish die after a cyanobacterial bloom and crash?…
2573 What are two functional mechanisms plasmids use to maintain themselves in host cells?…
2574 In bacteriorhodopsin, light striking the protein causes a pmf by:…
2575 You are replicating the classic Luria-Delbruck experiment. Ten cultures of <em>E. coli</em> are grow…
2576 A difference between neutrophils and macrophages is…
2577 After differentiation,&nbsp; immature T-cells go through an education process in the…
2578 Which of the following is how neutrophils will react upon infections?…
2579 A deadly pathogen, <i>B. Badgeri<strong>,&nbsp;</strong></i>is fatal to the host if it invades and c…
2580 Which type of immune response listed below is are inducible and are part of the adaptive immune resp…
2581 The skin protects us from pathogens by (three answers are correct)…
2582 Our bodies have many physical barriers to pathogens. These include: (There are three correct answers…
2583 Match the antimicrobial secretion with its activity…
2584 The complement cascade can be triggered by (two answers are correct)…
2585 Phagocytes are attracted to pathogens by…
2586 What measures could you take to control the current epidemic of COVID-19?…
2587 A Pattern Recognition Receptor will react with…
2588 These cells can present antigens to T-cells <strong>and</strong> B-cells (There are two correct answ…
2589 A major difference between SARS-CoV-2 (COVID19) the Rhinovirus and Influenza A is?…
2590 T-cells activate when an antigen is presented to them in the context of…
2591 When B-cells activate, they differentiate into (there are two correct answers)…
2592 These antibodies have 10 antigen-binding sites.…
2593 What is true of elementary bodies in the context of chlamydia?…
2594 In investigating the transmission of SARS-CoV-2 (COVID-19), which of the following is probably not a…
2595 Pathogenic <em>E. coli</em> strains often have fimbriae as virulence factors. What step of infection…
2596 TcdA and tcdB are proteins that disrupt Rac and Rho GTPases in cells. They are examples of…
2597 Match the cause of the illness with disease symptom(s)…
2599 What does NOT describe B-lymphocytes?…
2600 When enterohemorrhagic <em>E. coli</em><em> </em>infects the small intestine, it is difficult for th…
2601 Even though this bacterium is a strict anaerobe, it still transmits easily because it can form endos…
2602 Some people fear that SARS-CoV-2 (COVID-19) will mutate over time (as the flu virus does) making rep…
2603 Match the pathogen with its treatment…
2604 A characteristic of neutrophils that does not apply to macrophages is:…
2605 Pattern Recognition Receptors (PRR) are a family of receptors&nbsp;that are present on immune cells …
2606 Which innate immune response do PRRs (Pattern Recognition Receptors) participate in?…
2607 When someone gets the common cold which of the following is not a step of an adaptive response to fi…
2608 You&rsquo;re walking through the Arboretum with a friend when an angry badger jumps out and bites yo…
2609 What are prions and why are they so dangerous?&nbsp;…
2611 Which of the following is true regarding the activity of MAMPs and DAMPs during the immune response?…
2612 The overuse and misuse of antibiotics causes pathogens to become _____, which can be mitigated by __…
2613 One complication that may occur when an individual is infected with <em>Clostridium difficile</em> i…
2614 You are a doctor at UW Hospital. A patient comes in with a sexually transmitted disease. You perform…
2616 You are hiking at Wyalusing State Park along the Mississippi River during the spring to get some fre…
2617 You are the president of the United States, what the most effective method of slowing the spread of …
2618 What usually must happen upon attachment and entry of a host cell by a pathogen?&nbsp;…
2620 In developed cities, water is first treated with chlorine, lime and alum and put in sedimentation ba…
2621 Which of the following is a possible molecular mechanism microbes use to develop resistance to antib…
2622 Regarding the difference between dendritic cells and macrophages, which of the following is true?…
2623 The reason COVID-19 can be deadly to people with autoimmune conditions is because...…
2625 A major step in&nbsp;water processing&nbsp;before it is consumed by humans is that&nbsp;…
2626 A number of vaccines are being created for SARS-CoV-2 (COVID-19). The best vaccine against this viru…
2627 Moderna Inc. has developed an mRNA vaccine that when injected into patients causes host cells to mak…
2628 Match the antibiotic with its target…
2629 A successful strategy for slowing the development of antibiotic-resistant bacterial strains is…
2630 Molecular mechanisms for antibiotic resistance include:…
2631 Which of the following statements regarding John Snow's studies of water quality is TRUE?…
2632 Which of the following describes the role of the secondary immune system?…
2633 Which of the following is NOT a&nbsp;component of the IgG antibody?…
2634 Which of the following is a function of the IgG&nbsp;monomer antibody?…
2635 Which of the following is the target of &beta;-lactam, an antibiotic?…
2637 Which of the following types of vaccine is matched INCORRECTLY with its example?…
2638 Which of these are indirect ways a disease can be transmitted from person to person?…
2639 Which of the following is <strong>NOT</strong> an effective way to combat antibiotic&nbsp;resistance…
2640 To cause disease, a pathogen must be transmitted from its reservoir to a host. Why is pathogen trans…
2641 What is a function of CD-8<sup>+</sup> T lymphocytes?…
2643 Which correctly describes exotoxins and/or endotoxins?…
2644 Which of the following actions would you not expect an immune hormone (a cytokine) to be involved in…
2645 Which of the following antibiotics target DNA replication by inhibiting topoisomerases?…
2646 Which of the following would be the best mitigation method for an outbreak of Malaria?…
2647 You are working with a patient who has become ill from&nbsp;<em>Badger fisheri,&nbsp;</em>a bacteria…
2648 You are enjoying the summer weather outside with a long walk throughout a park in Northern Wisconsin…
2650 One major difference between CD4<sup>+</sup> and CD8<sup>+</sup> cells is...…
2651 During a primary response,&nbsp;B cells differentiate into plasma cells and secrete&nbsp;what antibo…
2652 Which of the following statements about phagocytes is incorrect?…
2653 During infection, the role of neutrophils does <strong>not</strong> include…
2654 How do better living conditions and improved nutrition limit the spread of disease?</p> <p>&nbsp;…
2655 Which of the following is FALSE regarding how T-cells sense a host cell is infected?…
2656 What are some of the features and their roles of the skin that protect against microorganisms?…
2657 Every year, the public is advised to receive a vaccine for Influenza in order to prevent the number …
2659 Which of the following is not a process in T-cell maturation?…
2660 During the sanitation process of water, which of the following are not added to the sedimentation ba…
2661 What is a distinctive feature that SARS-CoV-2 (COVID-19) has that other common viruses do not have?…
2662 Which of the following is CORRECT about Influenza A?…
2663 Human Papillomavirus (HPV) is a common cause of ________. It causes this by integrating into the gen…
2664 In the complement cascade...…
2666 Which of the following is <strong>not</strong> an element&nbsp;of T cell activation and activity?…
2670 Why is&nbsp;<em>Borrelia burgdoferi&nbsp;</em>able to so easily spread through the skin and blood du…
2671 Which of the following statements is false regarding Rhinoviruses?…
2672 You experience an gut infection in the mucosal membrane.  Which type of antibody would you most like…
2674 The enzymatic system is a part of the complement system, and&nbsp;has 9 proteins.&nbsp;Which of the …
2679 Which type of cell is the first to detect pathogens and activate the adaptive immune system?…
2681 Chronic Wasting Disease (CWD) in deer, elk, and moose populations currently has no known forms of tr…
2682 Which of the following correctly outlines differences between live attenuated vaccines and dead viru…
2685 Which of the following components of the skin listed below is incorrectly defined in how it acts as …
2686 There are numerous types of DNA viruses present. Papillomaviruses are significant compared to other …
2687 Endotoxins are found in <em>Escherichia coli</em> and...…
2688 Which of the following regarding rhinovirus is INCORRECT?…
2689 You are cutting an apple and all of a sudden the knife slips and you cut your finger. Pathogens begi…
2690 Which of the following is NOT a molecular mechanism&nbsp;of acquired antibiotic resistance employed …
2691 Neutrophils are…
2692 What is the correct statement regarding the process and function of natural killer cells?</p> <p>…
2693 <em>Chlamydia trachomatis</em>&nbsp;is a common STI that&nbsp;is one of the leading causes of pelvic…
2694 Which of the following is a good method for controlling a viral epidemic?…
2695 Which of the following does not correctly match the body part and its movement to functionally prote…
2696 The early epidemiology investigation conducted by John Snow proved what about the association betwee…
2698 What makes a natural killer cell similar to a cytotoxic T cell? …
2699 Which cell is an antigen presenting cell and what role do they play?…
2700 Which of the following complement proteins enhances the phagocytosis of macrophages?…
2701 Which of these processes is used when the immune system is fighting an extracellular pathogen and wh…
2702 The virulence of&nbsp;<em>Borrelia burgdorferi&nbsp;</em>is unusual because it does not produce or u…
2704 The TLR1:TLR2 heterodimer is usually present within host cells. Considering that this pattern recogn…
2706 How do component vaccines work?…
2707 What measures could you take to control the current epidemic of COVID-19?</p> <p>&nbsp;</p> <p…
2708 Which of the following proteins involved in the complement system is known to coat the bacterial cel…
2709 What is the role of opsonin’s in aiding phagocytosis?…
2712 What is the most distinguishing feature of a type III secretion system, and what is its function in …
2717 In the activation of B lymphocytes, binding of the antigen immediately causes...…
2720 Which of the following is <strong>NOT</strong> a mechanism used by microbes as method of antibiotic …
2722 We learned of two pathogens that cause diarrhea. What makes <em>C. difficile</em> different from <em…
2723 Studying microorganisms is worthwhile because…
2724 What makes bacteria great model organisms?…
2725 These  structures can function to make a microorganism motile…
2726 These structures can serve as methods of attachment in bacteria.…
2727 This structure is involved in fatty acid and&nbsp;phospholipid synthesis in eukaryotic cells…
2728 DNA needs to be condensed and highly organized in cells. In bacteria this is accomplished by what tw…
2729 Look at the following sequence</p>   CATACATA<strong><span style="background-color:#1abc9c;">TTGAC…
2730 A distinguishing feature between DNA and RNA is that DNA is double-stranded and RNA is not…
2731 The evidence in support of Dr. Lynn Marguilis' endosymbiosis hypothesis is that mitochondria and chl…
2732 Which of the following are traits of the Actinobacteria?…
2733 All of the following are traits of the Actinobacteria except for...…
2734 These Archaea produce methane as a product of their metabolism…
2766 Without carotenoids, a plant could not effectively (check all that are correct):…
2767 The adenine pump's gene expression is turned on when adenine rises to a high enough level in the cel…
2768 In Gram-positive quorum sensing, such as that observed for <em>Staphylococcus aureus</em>, RNA III r…
2769 Imagine you have an <em>E. coli</em> strain where the <em>crp</em> gene that encodes the cAMP recept…
2770 In <em>E. coli </em>the heat shock response is regulated (select all that are true)…
2771 You have isolated a novel, Gram-negative, lignin-degrading bacterium, but have not obtained its sequ…
2772 Which of these sequencing methods uses a pore that the DNA runs through and determines the sequence …
2773 <i>Leptospirillum</i> <em>ferroxidans</em> are found in the acid mine. Select the statements that ar…
2774 An example of an Archaeon that is found in the acid mine that does not contain a cell wall is…
2775 &lt;i&gt;Peligabacter ubique&lt;/i&gt; is (Check all that apply)…
2776 Some nitrogen-fixing bacteria enter mutualistic relationships with plants. Some animals also have mu…
2778 <strong>Strong</strong> evidence that the microbiome has a role in depression is...…
2779 The most likely explanation for the large time gap between Thonis Philipszoon viewing microbes and s…
2780 What do Gram-Negative and Gram-Positive cell membranes have in common?…
2781 From a human perspective, which of the following are helpful activities of microbes? (Choose all tha…
2782 Match the scientist to their discovery…
2783 Amino acids are monomers that are used in (select all that are true)…
2784 Arrange the steps of viral infection in the correct order.…
2785 Viruses can have various structures that enclose the viral nucleic acid. These include (select all t…
2786 The SARS-CoV-2 virus is a single-stranded, (+) strand RNA virus. Therefore it must…
2787 Which is not true about the relationship between prions and viruses?…
2788 You are studying an unknown bacteriophage's replication cycle. In looking at the viral genome, you …
2790 Endotoxins are long lipopolysaccharide molecules anchored to the outer membrane of certain types of …
2792 A key difference&nbsp; when comparing the differences between the structures of lipid and sugars is …
2795 A similarity between the structures of nucleic acids and polysaccharides are that they...…
2796 What do archaea cell membranes have that bacteria and eukaryote cell membranes are lacking?…
2797 A single-stranded negative RNA virus needs it&#39;s own DNA polymerase, but a single-stranded positi…
2798 Why is DNA used to store hereditary information?…
2799 Why are microbes limited in their size range?…
2800 What is the relative size range of most microbes?…
2801 Some Archaea are uniquely adapted to survive extreme environments. Which modification best allows fo…
2803 Suppose you discovered a new microbe (Microbe X). Someone asks you why this is important, you answer…
2804 Which of the following&nbsp;structures or molecules&nbsp;are present within the cells of&nbsp;<stron…
2806 All of these are problems with this definition of a species &ldquo;Bacterial and Archaeal species ar…
2808 Which statement is&nbsp;correct regarding&nbsp;the difference between bacterial swimming and twitchi…
2809 Microbes impact human lives by...&nbsp;(Select all&nbsp;that apply.)&nbsp;…
2810 What did Edward Jenner inject his young patient with in order to improve on variolation?&nbsp;…
2811 A Gram-positive bacterial cell&nbsp;had prolonged exposure to lysozymes. How will the staining of th…
2812 As a curious young researcher you decide to swab the surface of your phone, directly rub this onto a…
2814 In order for microbes to be observed in the laboratory, a suitable medium needed to be developed. Wh…
2816 All of the following are true concerning the contributions of microbes except,&nbsp;…
2817 Which of the following are functions of a cellular membrane?…
2818 One major difference between a prion and a virus is that…
2820 Which of the following is NOT found in the densely packed cytoplasm of bacteria?…
2822 <img alt="" src="http://organismalbio.biosci.gatech.edu/wp-content/uploads/2018/12/1600px-Phylogenet…
2823 Prions are different from viruses in that they...…
2824 What microbial discovery allowed Carl Woese to introduce the three Domain concept?</p> <p>&nbsp;<…
2826 While they are both phages, the lambda phage and T4 phage differ because...&nbsp;…
2827 What would happen if the promoter sequence of a gene was mutated so that RNA polymerase almost never…
2828 Which of the following is NOT a similarity between T4 and&nbsp;λ?…
2831 Which of the following is the correct pair of differences between viruses and prions?…
2832 Determine the sequence of the amino acid chain using the following mRNA molecule. Begin at the first…
2833 One way to characterize Bacterial and Archaeal species was when there was more than 70% DNA hybridiz…
2834 Suppose you isolate protein from a new strain of bacteria. You hypothesize that this enzyme catalyze…
2835 Which of the following uses rotary motion to push or pull the cell?…
2838 Which of the following is more likely to be found in a Gram-Positive membrane than a Gram-Negative m…
2839 What is the correct order of steps in a viral infection and release of a lysogenic phage such as λ?<…
2840 Why do both bacteria and eukaryotes have the Krebs/Citric Acid cycle if only eukaryotes have mitocho…
2841 Select each answer that correctly matches a structure of the Gram-negative or Gram-positive cell and…
2842 Select all the ways that microbes can impact our lives …
2843 An abundant phylogenetic group of Archaea called the methanogens is known for producing methane. For…
2844 Lysozyme targets peptidoglycan&nbsp;and is therefore most effective in degrading the cell envelope o…
2845 Below is a DNA sequence of the coding strand of a gene. Using the DNA sequence,&nbsp;find the&nbsp;a…
2846 What would be a downfall of failing to stain a specimen when observing it with a bright-field micros…
2847 All of the following are true of a eukaryotic cell membrane except...…
2848 Using a symporter in facilitated diffusion, all of the following statements are true except...…
2852 Carl Woese&#39;s use of 16S&nbsp;rRNA was very beneficial in his studies of evolutionary relationshi…
2855 Which of the following is true regarding the peptidoglycan layer in Gram-positive or Gram-negative b…
2856 <em>Rhizobia</em> are bacteria that participate in Nitrogen fixation after establishing themselves i…
2857 Which of the following statements is TRUE of the S-Layer on the outside of the phospholipid bilayer …
2860 Four 16S rRNA sequences are obtained. You need to decide which two are the most related and which tw…
2862 Your roommate&nbsp;was told to culture a new penicillin-resistant bacteria, and determine whether th…
2863 Prior to technology to sequence RNA, what evidence did scientists have for the theory that mitochond…
2866 Regarding the steps of a viral infection, which one of the following lists the steps in the correct …
2869 Which of the following methods of passing through a cell membrane does <strong>not</strong> require …
2871 The phyla Crenarchaeota contain a cell membrane composed of lipids. How are the lipids linked and wh…
2873 Match the viruses to the characteristics specific to them.…
2874 The human rhinovirus (also known as the common cold),&nbsp;a single-stranded RNA eukaryotic virus, m…
2877 You are trying to derive the evolutionary relationship between 5 closely related bacteria cells. Wha…
2878 One cell structure that is unique and distinguishes the cyanobacteria group is...…
2879 What is a cellular structure that can&nbsp;be found and used to distinguish the family of the Firmic…
2880 Pick the structure that corresponds with the proper function.…
2882 Select all of the following ways that microbes impact our lives.…
2885 You have been tasked with investigating the structure of a specific membrane protein in a bacterial …
2888 If a bacterium with&nbsp;type IV pili needs to slowly&nbsp;move across a surface, what type of motil…
2890 Some bacteria are known to cause disease and infection in humans, and therefore must be able to get …
2892 Where is the periplasm located?…
2893 Which of the following is true about the initiation stage of transcription in Archaea?&nbsp;…
2897 What features of the 16S rRNA would<strong> not </strong>make it useful to compare the evolutionary …
2898 When 16s rRNA of a chloroplast was originally sequenced and aligned with that of bacteria, it was fo…
2900 Which is an enzyme that humans produce, as discussed in lecture, that is a threat to many bacteria?…
2901 Which of the following statements is false regarding the use of bright-field microscopy?…
2904 Which two organisms are the most and least closely related based on the following 16S rRNA sequences…
2905 Energy, such as ATP and high-energy compounds, is necessary for transporting macromolecules via the …
2906 Which option does NOT is not a valid piece of evidence that supports that mitochondria evolved from …
2907 Pili and flagella share these functions in common…
2908 If a bacterial cell was starved for iron in a system, which of the following systems would be greatl…
2909 All of these are true regarding substrate level phosphorylation (SLP) EXCEPT:<…
2910 The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c…
2911 The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c…
2912 The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c…
2913 Microbes can be found in even in your refrigerator! Which of the following would best describe the m…
2915 <img alt="Fermentation - Chemistry LibreTexts" src="https://instruction.bact.wisc.edu/vmicro/web/ima…
2917 All the following are end products of Heterofermentation except…
2918 <img alt="CELLULAR METABOLISM AND FERMENTATION" src="https://instruction.bact.wisc.edu/vmicro/web/im…
2919 You are brewing a batch of 10 Forward Brown Ale (yes that is a Next Generation reference) that you b…
2920 Your friend wants to make cheese, but instead of milk they want to use unsweetened almond milk (0.41…
2921 The electrons on electron carriers such as NADH are donated to the electron transport chain. During …
2922 Substrate-level phosphorylation (SLP). (Check all that apply)…
2923 A major difference between anoxygenic photosynthesis and oxygenic photosynthesis is that:…
2924 Which of the following statements is true about&nbsp;turbidity in measuring microbial growth?…
2925 You have a microbe that does not divide by binary fission, but instead forms long filaments. How cou…
2926 High temperatures kill microorganisms by…
2927 You want to ship your freshly picked, and packed strawberries across the country. Before you do, wha…
2928 Which of the following <strong>do not</strong> describe the roles of Fe or Mg in enzymatic reactions…
2929 Which of the following elements are considered macronutrients?…
2930 What is true of the photophosphorylation reaction center of oxygenic cyanobacteria?…
2931 If you increase the concentration of the substrate in a reaction, what happens to the rate of the re…
2932 Your area has suffered a hurricane and the power is out. It appears that it will be out for at least…
2933 In the formation of ethanol, glucose undergoes catabolism to create pyruvate. The pyruvate is decarb…
2934 If you sterilize milk using ultra-high-temperature pasteurization (140-150 &amp;deg;C for 3 second) …
2935 You have isolated 2 new microbes from Yellowstone National Park. You want to classify them, so you t…
2937 Here are two half reactions. Predict which way the reaction would go and what the half reactions wou…
2939 A difference between cells in biofilms and planktonic cells is that...…
2940 The blue-green algae blooms that appear&nbsp;on Lake Mendota during the summer are a type of cyanoba…
2942 Use the table below solve this half-reaction problem. Look at these two half-reactions. Predict whic…
2943 I want to measure the bacterial population on a McDonald&rsquo;s hamburger after an incubation perio…
2944 A major difference between irradiation and pasteurization is that...…
2945 What would be unique in a bacteria species that forms biofilms compared to a bacteria species&nbsp;t…
2946 How is the light-harvesting center in green bacteria different from the light-harvesting center in p…
2947 Which element found in all microbes is correctly paired with its use in the cell?&nbsp;…
2951 Which of the following choices is INCORRECT regarding anoxygenic photophosphorylation...…
2953 The following are true of substrate level phosphorylation and oxidative phosphorylation (select all …
2955 What mechanism is shared between Photosynthesis and Retianl-based Phototrophy? …
2956 In a hot spring, a microorganism that is a _________, has adapted to this environment by having ____…
2957 Which of the following is false regarding biofilms?…
2960 Which of the following is NOT a correct statement regarding anaerobes, aerobes, and micro-aerophiles…
2961 Which of the following is true regarding the difference between purple bacteria and cyanobacteria in…
2962 The cytochrome b/c<sub>1</sub> complex in the electron transport chain shuttles electrons with the h…
2963 You want to grow a culture of a specific type of microbe. This microbe is non-fastidious and you wan…
2964 An unidentified microbe is found to use light as an energy source. This microbe is also found to use…
2965 In order to adapt to its changing environment, what must a microbe do when temperatures rise and wat…
2969 When <em>E. coli</em> is deprived of nutrients, the activity of which protein would be expected to i…
2970 A bacterium with no electron transport chain relies on glucose for energy in an anaerobic environmen…
2971 Your research mentor has found a new microbe living in Lake Mendota. Not much is known about the mic…
2974 You are hoping to preserve some of your summer/fall harvests to use in the winter by canning. You pl…
2976 ATP synthesis occurs at the ___ complex of ATP synthase when the proton motive force becomes energiz…
2983 What is the growth rate for yeast with and without the presence of oxygen? Further, pick the answer …
2984 You are a manufacturer of numerous plastic&nbsp;products. In accordance with&nbsp;regulations, you a…
2986 You decide to carry out an experiment to see the growth curve of two different microorganisms (A and…
2987 ____________ radiation, in the form of ___________, can kill microbes by ___________.…
2988 Which of the following are classified as micronutrients of cells?…
2990 Select all of the following statements that are true about the light-harvesting centers in purple, g…
2993 Of the following common elements essential for microbial life, which is correctly matched with its u…
2994 The following reaction is taking place in a cell: A + B&nbsp;&rarr; C + D. What will happen to the r…
2999 Electron transport chains use energy from high energy electrons to pump protons across membranes. Wh…
3002 Which of the following is false about ATP synthase …
3003 A microbe lives at the bottom of the marina trench and uses chemicals as its energy source, the micr…
3005 Pick the correct comparison between sterilization and pasteurization . . .…
3009 Which of the following is TRUE of oxygenic photosynthetic bacteria?…
3015 Recently, your facility has&nbsp;had problems with eliminating endospore-forming bacteria on its med…
3016 If we have a reaction: A+B--&gt;C+D, we have 1.0 mol of A, 1.0 mol of B, 1.0 mol of C, and 1.0 mol o…
3017 The antisense RNA in quorum sensing turns up the translation of some genes and turns down the transl…
3018 You decide to expose some bacteria in your microbiology lab to a UV lamp. Before you start, what typ…
3020 A strand of DNA has a mutation in which a T-T dimer has formed. What most likely caused this mutatio…
3022 Which of the following can be found on plasmids that are commercially available for research…
3023 <i>Peligabacter ubique</i> is (select all that apply)…
3024 Consider the symbiosis between the tubeworm and sulfur-oxidizing bacteria. Which of the following st…
3025 Looking only at a DNA sequence of bacteria, you can tell if horizontal gene transfer is present if</…
3026 Cellulosomes are useful in the degradation of cellulose because:…
3028 You mutate a strain of&nbsp;<em>Staphylococcus aureus&nbsp;</em>so that AgrC is not bound by AIP.&nb…
3031 What most accurately describes what happens when a plasmid, which has a Toxin-Antitoxin System, is l…
3032 What would happen if <em>Staphylococcus aureus </em>had a deleterious frameshift mutation in the gen…
3033 Why are cellusomes&nbsp;efficient cellulose degraders?…
3037 Which of the following comparisons between deep sea ocean vent and lake primary producers is correct…
3040 Which of the following mutations in the tryptophan operon will result in an &ldquo;OFF&rdquo; operon…
3043 A mutation that prevents the formation of the secondary structure of the <em>rpoH</em> gene&nbsp;wou…
3044 A DNA sequence appears to have undergone a frameshift mutation in which an adenosine&nbsp;was insert…
3047 If UV light damages the DNA, how would you repair it?…
3048 Which of the following is true about plasmids and chromosomes in bacteria?…
3049 You want to mutate a plant using CRISPR, your goal is to replace a known acid-producing gene with an…
3050 Match the microbe to its role in the Nitrogen cycle…
3051 Which of the following is a way that plasmids maintain themselves in a host cell?…
3052 Which of the following best describes the difference between a deep sea ocean vent and a lake?&nbsp;…
3053 There is a mutation in DnaJ that does not allow RpoH to bind properly. What may happen as an outcome…
3055 Which is of the repair system pairings is incorrect?…
3056 Which one if these is NOT a difference between chromosomes and plasmids?…
3058 A mutated microbe is placed on agar that contains an antibiotic and turns a dark blue color while al…
3060 Methylmonoxoygenase (MMO) catalyzes the conversion of methane to methanol coupled with a reduction o…
3061 Many anaerobic bacteria employ cellulosomes as an alternative mechanism of cellulose degradation. Wh…
3062 Which of the following is not a required component to clone a target gene?…
3063 A mutation in <em>E. coli</em> causes a malformation of the cyclic AMP receptor protein, making it n…
3064 When considering respiratory chains, which of the following are factors that are included in Fe oxid…
3069 A base pair mutation inactivates TrpE, which codes for anthranilate synthase. This would most likely…
3072 While undergoing DNA replication, a mutation occurs that causes a G to pair with a T. The cell reali…
3073 <em>Phanerochaete chrysosporium</em>, a white-rot fungus, is able to degrade lignin by&hellip;…
3075 What would happen if a tubeworm were exposed to a respiratory poison?…
3078 Given there are three&nbsp;incorrect bases on one strand of DNA, ATCCGA is now AGGGGA, and the DNA i…
3079 After a cyanobacterial bloom and crash, there can often be a localized die-off of fish populations, …
3081 A mutation in the <em>LuxR</em> gene in a certain strain of <em>V. fischeri</em>&nbsp;makes the orga…
3082 <i>Leptospirillum ferrooxidans </i>is a Gram-negative, spiral-shaped microbe. It oxidizes Fe<sup>2+<…
3085 Which of the following hold true for the genetic exchange from a donor to recipient cell within bact…
3086 How does water affect abandoned open mines and how is it potentially a source of pollution?…
3092 Which of the following is&nbsp;true when differentiating between a chromosome and a plasmid?&nbsp;…
3093 Which of the following is true about the difference between chromosomes and plasmids?&nbsp;…
3094 You are studying a strain of pathogenic&nbsp;<em>S. aureus</em> and isolate a mutant with a structur…
3098 Which of the following regarding the ocean&rsquo;s chemistry is not true?</p> <p>&nbsp;</p> <p…
3100 Which of these microbes can perform photosynthesis under low light conditions and deeper depths of t…
3102 There is a mutation in the operator of the <em>lac</em> operon, preventing LacI (repressor) from bin…
3103 Denitrification often occurs under aerobic conditions…
3105 In an environment what determines whether sulfate reducers/methanogens-acetogens become the dominant…
3106 All of these are true regarding the detection of a pathogen in the body EXCEPT:…
3107 What is FALSE about flavonoids in the human body?  …
3108 In methanogens the proton motive force is generated by…
3109 Chloe has the genetic disease cystic fibrosis. Because of this, she has had frequent infections in h…
3110 All of the following are correct about the pathogenesis of <em>Staphylococcus</em> EXCEPT: </p>   …
3111 Which of the following is NOT used to treat HIV?<br />  …
3112 Which of the following are antigens that the body can react to in order to raise an immune response?…
3113 Which of the following is&nbsp;true of microbiota in the oral cavity?&nbsp;…
3114 If you removed all of the microbes typically found in the gut of a human and the gut of a cow so tha…
3115 All immune cells originate from bone marrow stem cells.…
3116 After ingesting a particle, a dendritic cell may migrate to the nearest ________ to present the anti…
3117 Which of the following can trigger the complement cascade? (select all that apply)…
3118 The activation of the complement system is detrimental to its target because the complement proteins…
3119 An epidemic of dancing flubitis has overtaken Madison. Victims get an overwhelming urge to perform t…
3120 Order the steps of infection…
3122 What is the role of CD8 cells in a cell-mediated immune response?…
3125 A(n) _________ pathogen can cause disease only in individuals that are compromised, while a(n) _____…
3127 Which of these are virulence factors for the Salmonella bacterium?…
3129 Imagine that almost all Americans get the COVID-19 vaccine. If a vaccine is 95% effective, will 5% o…
3130 Which disease is not infleunced by the imbalance of&nbsp;<em>A. muciniphila&nbsp;</em>in the human G…
3131 As I write this question the US has 14,769,353 cases of COVID-19 and 282,375 deaths. The US governme…
3132 Which of the following are potential strategies to combat the growing number of antibiotic-resistant…
3134 Ever since the pandemic began, you have tried to start eating healthy, and you decided to go vegan. …
3137 Which methods are effective ways to combat antibiotic resistance?…
3139 Cytotoxic T cells kill target cells by…
3140 Which of the following pathogens could illicit an immune response via endotoxin activity?…
3142 A syntrophy can be best described as:…
3143 Which of the following is NOT&nbsp;how&nbsp;physician John Snow dealt with the source of the Cholera…
3145 Select all that are true regarding T cell maturation and their tolerance mechanisms:…
3146 What are the notable differences between inflenza virus and SARS-CoV-2?…
3147 Match each of the steps of the inflammatory process with the correct sequential step&nbsp;in which t…
3148 Upon infection by a pathogen, which of the following organs would not be<em> directly</em> involved …
3151 Methanogens are necessary for the metabolism of <em>Syntrophomonas.&nbsp;</em>The syntrophic associa…
3152 Which of the following systems/structures in the human body&nbsp;plays a role in immunity?&nbsp;</p>…
3157 Your friend offered you this new magic pill that would make all your dreams come true. Oh no! The pi…
3161 All of the following are ways in which the COVID-19 epidemic could have been controlled better <stro…
3163 Which of the following descriptions describes the virulence factor(s) E. coli uses to compromise its…
3164 Select ALL the ways a disease can be transmitted from PERSON-TO-PERSON.&nbsp;…
3165 What is the role of a fomite in transmission of pathogens between humans?…
3167 The disease that is the main cause of infectious diarrhea contains tcdA and tcdB that damage cells b…
3170 What would be the most effective quarantine plan to follow after being exposed to a friend who teste…
3171 Number the immune response to a microbe in the order that they occur in the body. …
3172 A mutation is present in an <em>E. coli</em> cell that makes its T3SS protein overactive. What might…
3173 Antibiotics are an effective way of getting rid of bacteria. Since β-lactam antibiotics target cell …
3175 During T cell maturation&hellip;…
3178 Which of the following statements about the differences between humoral and cell mediated adaptive i…
3179 Evidence that vaccines work include?…
3180 Methanogens and acetogens are typically found together in the environment. When CO<sub>2</sub> and C…
3181 The most effective vaccine for SARS-CoV-2 should:…
3183 When defining disease, which of the following is true?…
3184 A female patient comes in with what seems to be an eye infection. You run a number of tests and disc…
3185 A teenager loses his balance while riding a bike and falls hard on the pavement. He realizes that he…
3186 How does the bacteria Spirochete, which causes Lymes disease, infect its host?…
3187 Which antibacterial drugs works by inhibiting the transfer of growing peptide chains and the&nbsp;in…
3188 Toxic megacolon caused by <em>Clostridium difficile </em>is the result of the expression of which to…
3191 You are an epidemiologist for Dane County and are trying to propose a method to stopping the spread …
3192 TCA and TCDB are exotoxins produced by <em>Clostridium difficile</em> that cause significant inflamm…
3193 Which of the following is the function of a Type III secretion system?…
3194 Why can Chlamydia cause persistent infections?&nbsp;Choose the best answer.…
3196 An outbreak of cholera is happening in Northern Wisconsin and epidemiologists are trying to find out…
3200 What determines whether methanogens or acetogens become the dominant consumer of hydrogen in an envi…
3203 A 27-year-old male who is moderately active and is overall healthy contracts enterohemorrhagic <em>E…
3205 The bar graph shows the incidence rate of a particular epidemic you are tracking. Based on this data…
3208 True or False: it is possible for microbes to live in phagocytes by&nbsp;inhibiting phagolysosome fo…
3211 Which of the following is true regarding the different types of immunity?…
3214 You are working as a doctor in a hospital and your newest patient has been describing how they have …
3215 Which of the following is true for a diet of meat, eggs, and shellfish that&nbsp;contains phosphatid…
3216 Which of the following is false about the complement mechanism to detect the presence of a pathogen?…
3218 Which of the following is not a molecular mechanism for antibiotic resistance? …
3222 Could a fecal transplant of the microbiome of a thin individual into an obese individual help them l…
3223 If B cells could only make plasma cells, what would happen next time you encountered the same infect…
3227 Between the early 2000s and 2010s,&nbsp;there was a significant decrease in the incidence of HPV. Th…
3230 If you transplanted microbes from someone who was vegan into your own gut, assuming you eat a balanc…
3231 Select all that are true about the structure of DNA and RNA…
3232 Which of the following lists the five steps of the viral life cycle in the correct order?…
3237 Comparing the viral structure and replication cycles of&nbsp;Qβ, T4, and λ which of the following an…
3238 According to the phylogenic tree below, which of the following groups are most closely related?</p> …
3239 Which of the following is a unique feature of Gram-positive bacterial cells?…
3240 What is a MAJOR difference between prokaryotes and eukaryotes in the process of translation?…
3241 In cyanobacteria, gas vesicles in the cytoplasm function to…
3242 You are viewing&nbsp;a Gram-negative&nbsp;bacterium. Which are you <strong>not</strong> likely to ob…
3243 RNA is <strong>not</strong> used for hereditary information because…
3244 Which of the following is false regarding archaea?…
3245 DNA is used for hereditary information and not RNA because...…
3246 Streptokinase can treat the following diseases (check all that apply):</p> <p>&nbsp;</p> <p>&n…
3247 A patient comes in complaining of an upset stomach after consuming dairy. What enzyme is their body …
3248 What is the process protease uses to break the peptide bonds within&nbsp;proteins called?…
3249 Nattokinase is useful for treating...…
3250 Keratinase is not found in…
3251 The most common source for xylanase production is...…
3252 The enzyme that further converts maltose transformed&nbsp;by amylases into glucose is?…
3255 Your friends want to have a big glucose factory, which he believes will help him make big money. You…
3257 What discoveries were made from wine and beer fermentation research?…
3260 What is the reaction that catalase catalyzes?…
3261 What effects would you see in a person with a missense mutation in the PKLR gene?…
3262 Trypsin is a useful treatment for</p> <p>&nbsp;</p> <p>&nbsp;…
3264 In the medical field trypsin is used with chymotrypsin to help...&nbsp;…
3266 Invertase is an enzyme that catalyzes the hydrolysis of sucrose into what two compounds?…
3268 Which&nbsp;enzymes help with the digestive process?…
3269 What is left when lactase breaks down lactose?…
3271 The mechanism of ATP synthase involves a…
3272 A bacterium that contains cytochrome oxidase is growing in a medium that contains glucose, calcium, …
3273 Which of the following correctly describes the role of chlorophyll and/or carotenoids in a reaction …
3275 Cyanobacteria utilize oxygenic photosynthesis; Heliobacteria utilize anoxygenic photosynthesis. What…
3276 You have a new bacterium that grows as long filaments that settle to the bottom of the growth vessel…
3277 Which of the following if false about carotenoids and chlorophyll?…
3278 Oxidative phosphorylation differs from substrate-level phosphorylation in that oxidative phosphoryla…
3279 A mutation causes the <em>rpoH</em> gene to not form a secondary structure, what phenotypic conseque…
3281 You are observing purple bacteria, which you know undergoes anoxygenic photosynthesis.&nbsp;Which of…
3283 A major difference between purple bacteria and green bacteria is…
3284 Given the chemical reaction below, which change would result in a decreased rate of reaction from re…
3285 A bacterium uses chemicals as its energy source, CO<sub>2 </sub>for its carbon source, and inorganic…
3286 For hundreds of years salting has been a method used to preserve foods. What is the BEST description…
3288 A student recently became interested in the fermentation processes behind many foods they enjoy. Whi…
3290 Which is the fastest indirect method to observe the growth of the culture?…
3291 Which of the following are differences of the metabolic role of microbes in humans versus ruminants?…
3293 Regarding Fred Griffith&#39;s experiments on transformation, which statement is <em><strong>false</s…
3294 What is the best way you can tell if a cell&#39;s DNA has gone through horizontal gene transfer?…
3296 Methanotrophs, heterotrophs, and autotrophs are microbes that play a role in the carbon cycle. Selec…
3297 The following is true about cellulosomes...…
3298 What are some possible outcomes from consuming a diet that is higher in phosphatidylcholine?…
3299 During replication, there was an incorrect pairing between one base pair on the parent strand with t…
3300 You are studying mutations and&nbsp;decide to&nbsp;hit a&nbsp;DNA&nbsp;strand with&nbsp;UV light. Yo…
3301 You observe a lake filled with lots of algae and murky water, indicating high biological activity oc…
3304 An important difference between B-lymphocytes and T-lymphocytes is…
3305 Which of the following are part of the innate immune system&#39;s way of fighting extracellular path…
3308 Phagocytes kill microorganisms using oxygen-dependent and oxygen-independent methods. Select all met…
3309 What in our skin helps create the barrier to microorganisms?…
3310 All of the following traits of skin help to create an ideal environment to act as a barrier against …
3311 Which of the following are virulence factors?…
3312 Which of the following water sanitation measures could&#39;ve prevented, or at least minimized the i…
3313 Human papillomavirus is a sexually transmitted disease that…
3315 Which of the following are characteristics of Lyme disease?…
3317 Match the scientist(s) to the discovery they made…
3318 A scientist claims to have discovered a coccus-shaped bacterum that is 0.02 µm in diameter. In your …
3319 Food is impacted by microorganisms in that…
3320 In terms of size and complexity, which statement best summarizes the differences between a bacterial…
3321 A cell from any living organism will contain (check all that apply)…
3322 If you look at the following list, what one thing must every microbial cell have.…
3323 Pili, flagella, and fimbriae are all anchored in the…
3324 Capsules in bacteria are most often made of…
3325 You are examining the properties of a mannose transport protein. It has a binding protein that captu…
3326 Taq Polymerase is an extremely themostable _____., that was isolated from _____,&nbsp; The bacterium…
3327 The ribosome is…
3330 A unique property of peptidoglycan is:…
3331 A bacterial cell inhabiting an aquatic environment is able to float to the air-water interface and t…
3332 Rifampicin is a drug that inhibits bacterial RNA polymerase. Since it is also a prokaryote, rifampic…
3333 What is the protein structure surrounding the virus called:</p> <p><img alt="A diagrapm of a viru…
3334 If the CII protein of the &lamda; bacteriophage had a mutation that completely inactivates it, the λ…
3335 Below is a list of famous microbiologists. Match them to their correct description.…
3337 If the MreB protein became inactive, the cell would probably...…
3338 What mechanism does penicillin use to stop bacterial growth?…
3339 The RNA polymerase of Archaea is similar to that of Eukarya in that…
3340 In DNA replication the role of Primase is to…
3341 Here is a set of alignments for 16S rRNA.</p> <p>&nbsp;</p> <table class="table table-striped"…
3342 Which of the following is <strong>NOT</strong> true of the Archaeal outer layers?…
3343 Which of the following is true regarding Bacteria and Archaea?…
3344 Why are lysozymes successful in inhibiting bacteria all the time, but penicillin isn&#39;t?&nbsp;…
3347 Select the statement(s) that is/are true about this phylogenetic tree...</p> <p><img alt="A Phylo…
3349 Which of the following is TRUE regarding DNA and RNA functions?…
3350 A newly discovered bacteria,&nbsp;&nbsp;<em>Iwanabedonewith thistest,</em> was discovered buried ben…
3352 Choose the following TRUE statement that is CORRECTLY matched to the organism…
3353 Which of the following is NOT a cytoplasmic structure in Bacteria?…
3355 What is unique to the lytic cycle?…
3356 Which of the following is <strong>false</strong> about RNA polymerase:…
3357 By the marvels of modern technology and a lot of digging, you have discovered what could possibly be…
3358 In bacteria FTsZ would be useful for which of the following?…
3359 If penicillin is active in a bacteria cell, what is the outcome?&nbsp;…
3361 Name&nbsp;one&nbsp;<b>difference</b> between a bacterial cell and a eukaryotic cell…
3362 A main difference between transcription and translation in eukaryotes and bacteria is that…
3363 What is a major difference between Archaea and Bacteria?…
3365 Name one <strong>difference</strong> between a bacterial cell and a eukaryotic cell…
3367 A pathogenic microorganism is tested for Gram&#39;s stain and you find that the microorganism stains…
3368 <a>Termination of Protein Synthesis takes place at all of these&nbsp;codons except.&nbsp;</a></p> …
3370 All of the following are true about lysozyme or penicillin except:…
3371 A major difference between the Rho-independent and Rho-dependent termination processes in prokaryoti…
3372 The bacterial nucleoid is commonly found in the center of rod-shaped bacterium. What is the main pur…
3373 The slow changing portion of the 16S rRNA allows for&nbsp;…
3374 What best explains why DNA is more stable than RNA?…
3376 What would be a possible reason why RNA viruses are more error-prone?</p> <p>&nbsp;</p> <p><br…
3378 Which of the following does not exist in the bacterial cell envelope?…
3380 The host cell that a lambda phage is residing inside is actively growing. Which of the following det…
3382 <em>Staphylococcus aureus</em> is growing rapidly in an organism, which drug would be the best to st…
3383 Does a Gram-negative or Gram-positive cell have a thicker layer of peptidoglycan? Select the correct…
3384 Why would some bacteria swim north in the northern hemisphere of the earth and south in the southern…
3386 Which of the following are reasons&nbsp;why DNA sequences found in a specific plasmid&nbsp;would&nbs…
3387 In what way did Walter and Angelina Hesse contribute to the early development of microbiology?…
3389 What is the main/primary difference between a nucleus and a nucleoid?</p> <p>&nbsp;</p> <p>&nb…
3391 All of the following are located in a Nucleoid except...…
3392 Which of the following statements about agar is TRUE?&nbsp;…
3393 Match the classification of viral genomes to how it is converted to mRNA.&nbsp;…
3394 How do the T4 phage and lambda phage differ from each other?&nbsp;…
3395 A new microbe was recently discovered&nbsp;containing a cell membrane with lipid side-chains compose…
3396 How is Archaea translation similar to Eukarya translation?&nbsp;…
3397 Which of the following factors would tend to increase membrane fluidity?…
3398 Why was Edward Jenner ahead of his time?…
3405 Why are lysozymes and pencillin more effective at destroying&nbsp;Gram-positive bacteria cell walls …
3407 Eukaryotes and Archaea differ from bacteria&nbsp;in that they.…
3409 After the process of Gram staining, if the cell retains the purple color from the crystal violet dye…
3410 What is unique about the structure of archaea and how does this affect its function in the environme…
3411 In the structure of lipopolysaccharide, which of the following parts make up lipid A (toxic componen…
3412 Which of the following best describes how penicillin inhibits the synthesis of peptidoglycan in bact…
3413 By forming a mesh in bacterial cell walls, peptidoglycan successfully…
3414 Three new birds were found on an island. They seem to come from a common ancestor, but as scientists…
3415 What is the mechanism the prion employs to cause disease?…
3416 What did Angelina and Walter Hesse contribute to modern-day microbiology?…
3417 Which of the following properties do Archaea and Eukarya <strong>not</strong> have in common?…
3423 Which of the following is a similarity between rho-dependent and rho-independent termination?…
3425 Knowing that Eukarya, Archaea, and Bacteria share a common ancestor who gave rise to many shared cha…
3426 Which of the following statements about taxis is INCORRECT?…
3428 You are conducting an experiment studying an exceptionally&nbsp;rare disease&nbsp;that involves the …
3431 Why is peptidoglycan important to bacterial cells?…
3432 What is the main difference between bacterial cell walls and eukaryotic cell walls regarding peptido…
3433 Robert Hooke&#39;s work in <em>Micographia</em> was important to future scientific discoveries becau…
3434 How did Anton van Leewenhoek&#39;s work change the way we study organisms?…
3436 Which steps are part of the lysogenic cycle, but not part of the lytic cycle?…
3437 A difference in the promoters of archaea and the promoters of bacteria is…
3438 A major difference between bacteria&nbsp;cytoplasmic membrane&nbsp;and archaea&nbsp;cytoplasmic memb…
3439 All of the following are functions of inclusions <strong>EXCEPT</strong>:…
3440 Lipopolysaccharide (LPS) is located...<br /> &nbsp;…
3441 Which one of the following statements is FALSE about the characteristics and functions of all microb…
3442 How do&nbsp;Type I pili and Type IV pili differ?…
3443 Which was <strong>NOT</strong> one of the problems faced with using gelatin to grow cultures?…
3444 Bacteria and Eukarya are similar in that they:&nbsp;…
3451 Carl Woese was the first...…
3452 Which type of membrane is most resistant to&nbsp;acid and heat because of ether-linked lipids...…
3453 Which of the following is NOT a true example of structure dictating function?…
3454 If penicillin inhibits peptidoglycan synthesis in cells, which type of cell(s) would generally be af…
3457 All of the following properties are true of the agar that Walter and Angelina Hesse discovered excep…
3458 An unknown organism is discovered to contain genes that code for peptidoglycan. Which domain/phyla i…
3460 What feature of the 16S rRNA does NOT make it useful from a evolutionary standpoint?…
3462 What is the difference between a nucleoid in a bacteria cell, versus a nucleus in a eukaryotic cell?…
3463 The following are all reasons to support the importance of studying&nbsp;microorganisms in a medical…
3465 In a phylogenetic tree of the three domains: Bacteria, Archaea, and Eukarya, which of the following …
3466 Select the statement that correctly compares a bacterial cell vs. a eukaryotic cell.&nbsp;…
3467 How do bacterial cells and archaeal&nbsp;cells compare?…
3468 All of the following are true about evolutionary relatedness of organisms EXCEPT...…
3470 Which of the following is NOT true about the structure of Peptidoglycan?&nbsp;…
3472 Transcription in bacteria consists of all of the following&nbsp;except…
3473 Which of the following statements&nbsp;correctly differentiates&nbsp;between the promotors of bacter…
3474 In a laboratory setting, you isolate a protein complex from a reproductive&nbsp;process within a pro…
3477 Choose the correct statement regarding metabolism…
3479 A bacterium was found to undergo aerobic cellular respiration. In order to generate a proton gradien…
3481 A groundbreaking new bacteria species was found in Lake Mendota. As a researcher at the University o…
3482 A lactic acid bacterium (<em>Streptococcus gordonii</em>) in your mouth grows on sugars and produces…
3483 A major difference between homofermentation and heterodermentation in glucose fermentation is...?</p…
3484 What is the key difference between a defined medium and a complex medium?…
3485 You are starting a new fruit juice company with your cousin and want to check that there are no cont…
3486 Which of the following accurately describes the role/structure&nbsp;of the reaction center in photos…
3488 You discover a new photosynthetic bacterium and begin to characterize its electron transport chain. …
3489 You are a research scientist and you have just discovered a new species of bacterium. This organism …
3490 The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c…
3493 Which of the following is true about the MinCDE and FtsZ system?…
3495 The Light Harvesting Center of a cyanobacteria is thought to have evolved and taken parts of both th…
3496 What is one key similarity&nbsp;between growth factors and trace elements?…
3499 A novel microorganism is found to express the enzyme superoxide dismutase. The new microbe could pot…
3500 How have microbes, categorized as thermophiles,&nbsp;adapted to living in the extremes of their envi…
3503 What role do purple bacteria play in the research of photosynthesis?…
3504 Which foods use lactic acid bacteria as a part of their fermentation process?…
3506 Calculate the growth rate of this sample bacteria&nbsp;between 11 AM and 3 PM&nbsp;using the data ta…
3507 Based on the data table below, calculate the growth rate of both organism X and organism Y. Which or…
3509 <em>Lactococcus lactis</em> is an aerotolerant anaerobe. It is grown in the same medium, but Culture…
3512 If a microorganism is in the presence of a predator, which of the following would <strong>not</stron…
3513 What components are reused in respiration of fats and sugars?…
3514 Which of the following statements is TRUE regarding cyanobacteria&#39;s response to environmental co…
3515 You are pickling some beets and want to eliminate any possible <em>E. coli</em> contamination during…
3516 All respiration systems that have been discovered so far involve which of the following (choose all …
3517 Which of the following is correctly paired with its definition?…
3519 A certain microbe requires the growth factor biotin. Which of the following statements can be reason…
3520 Which of the following groups of organisms are involved in chocolate fermentation (choose all that a…
3521 Your company wants to manufacture special colored Kim Chi for the winter holidays. Your boss suggest…
3522 β oxidation results in the production of acetyl-CoA and reduced electrons in the form of FADH and NA…
3523 Match the set of elements or molecules to their nutritional classification…
3524 You are trying to study the growth characteristics of a bacterium that grows only using filamentous …
3525 Which of the following fermentations does NOT result in the production of lactic acid?…
3526 A microorganism that lives in coral reefs, an oxygen abundant environment, but does not use oxygen i…
3527 During the fermentation progression of making Kimchi…
3530 You have successfully grown bacteria in the lab. However,&nbsp;you notice that the cells present wer…
3531 How do myxobacteria respond to nutrient deprivation?…
3532 Oh no! Your nephew spilled your microbial isolate from lab all over himself and the table. How would…
3533 Which type of cyanobacteria environmental&nbsp;response results in the fixation of nitrogen?…
3534 Classify each of the following as either a macronutrient, micronutrient, trace element or growth fac…
3535 A major difference between trace elements and growth factors is that…
3541 What is the major component that differentiates&nbsp;green bacteria from purple and cyanobacteria in…
3542 Your friend heard on Facebook that you could use the biocide glutaraldehyde to kill the coronavirus.…
3543 Carbon, Hydrogen, and Nitrogen are examples of&nbsp;<u>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nb…
3546 Where are acidophiles located?…
3547 Determine the drop in electron potential&nbsp;of the following reaction.</p> <p>2O<sub>2</sub>&nb…
3549 A photoautotrophic lithotroph…
3550 Which of the following components does&nbsp;<strong>not</strong> assist the reaction center in recei…
3551 What is the drop in electron potential of the following reaction?</p> <p>NO<sub>3</sub><sup>-</su…
3553 Certain temperature resistant microbes adapt to extremely low temperatures at the molecular level by…
3555 UH-OH! You&#39;re studying a newly discovered microbe but accidentally dried&nbsp;out the only sampl…
3557 Match the light-harvesting complex structures to the correct phototroph.…
3562 What physical agent would be best to remove/kill microbes&nbsp;that produce endospores?…
3564 Imagine that you are a singular cyanobacterium. There is not a lot of cyanobacteria in your area and…
3571 What makes Substrate-Level Phosphorylation (SLP) a unique part of fermentation?…
3572 Why are purple bacteria great model for research?&nbsp;</p> <p>&nbsp;</p> <ol> </ol> <p>&n…
3574 Below are two half reactions. Which way will the reaction go and what is its&nbsp;potential energy?<…
3576 Identify the true statement about retinal-based phototrophy vs the photosynthetic apparatus of purpl…
3579 How is retinal-based phototrophy different than the photosynthetic apparatus of purple bacteria?&nbs…
3580 Which of the following is not a function of carotenoids?…
3589 In alcohol fermentation, glucose is broken down into ethanol and CO<sub>2</sub> while energy in the …
3590 Say you are making a batch of chocolate that will be fully fermented after seven days. Which type of…
3591 Which of the following characteristics is correctly paired with the cells&#39; method to approach nu…
3594 Which of the following will increase the rate of the reaction forward?…
3597 What differentiates homofermentation and heterofermentation?…
3598 What do heterocyst do for Cyanobacteria?…
3600 Which of the following is a component of light harvesting complexes that is unique to green bacteria…
3603 If you have removed pathogens from living tissue, you have performed…
3608 The major difference between photoautotrophic lithotrophs and chemoautotrophic lithotrophs is that&n…
3610 Which of the following physical agents would be used to extend the shelf life of farm-picked strawbe…
3614 What protein is used in retinal based phototrophy?…
3615 Which&nbsp;electron, carbon, and energy source do chemoheterotrophic organotrophs use?…
3616 What is the role of trace elements in the cell?…
3619 In which of the following conditions would you expect the formation of heterocysts?…
3624 Match the phase to the statement that best matches&nbsp;what might be happening at each point on the…
3629 What&#39;s an isolation technique to select for the desired metabolic capacity of a cell?…
3630 Imagine a mutant where the tryptophan codons in the leader peptide of the <em>trp</em> operon are re…
3631 AgrC of the <em>agr</em> operon of <em>Staphylococcus aureus</em> has a mutation that makes it alway…
3634 Proteins involved in the heat shock response fall into a number of categories. (Select all that are …
3635 In quorum sensing in <em>Staphylococcus</em><em> aureus</em>, once RNA III is made it affects the ex…
3636 Plasmids may maintain themselves by... (select all that are true)…
3637 Microbes in acid mines can obtain their carbon by... (select all that apply)…
3638 Prior research has demonstrated that various eukaryotes, such as fungi and protists, reside inside a…
3639 You isolated a novel thermophilic bacterium, <em>Bacillus badgerus,</em> using a selective minimal m…
3640 Based on what you know about the community physiology of microorganisms, which of the following stat…
3645 A major difference between cellulose degradation systems in aerobic and anaerobic bacteria is: </p> …
3646 You have the complete genome sequence of <em>Bacillus badgerus</em>. Your next goal is to find open …
3647 You have found four candidate β-glucanases in <em>Bacillus badgerus</em>. What is the most efficient…
3648 Horizontal gene transfer by conjugation can occur between different species.…
3649 Candidate mutants of <em>Bacillus badgerus</em> is grown up as isolated colonies on rich medium. It …
3650 Of the three methods of DNA sequencing we discussed, which one does not require the synthesis of DNA…
3651 Because of advances in culturing methods, it is now possible to bring most microorganisms present in…
3652 Is culturing microbes an effective way of learning what is in the environment?&nbsp;&nbsp;…
3654 The protozoa living in acid mines are…
3655 Why is the cell&#39;s lactose operon NOT induced in the presence of both glucose and lactose?&nbsp;…
3659 Choose the CORRECT regulation mechanisms involved in the heat shock response.…
3662 Which one of the following is used to classify a lake that is <strong>low </strong>in nutrient level…
3663 Which of the following options is a not characteristic/machinery of a soil environment?…
3665 Which season(s) does lake mixing occur and why - what is the consequences of this in regards to oxyg…
3666 An example of a chemoorganoheterotroph found in the deep ocean vent community is...…
3667 Which of the following is a correct sensor kinase/response regulator pair (and in that order)?  …
3668 The thiamine mRNA transcript can have its expression altered by the binding of thiamine (a metabolit…
3672 A major difference between selection and screens&nbsp;is…
3676 Which one of the following phylotypes&nbsp;was <u><strong>NOT</strong></u> found in the <em>ocean</e…
3677 Your microbiology lab professor ask you to come up with ideas to mutagenize the cells for the experi…
3678 You are researching microbial communities in acid mine runoff. The specific type&nbsp;of microbes th…
3679 Which of the following statements is TRUE about denitrification?…
3681 When adenine binds to RNA to form the <em>ydhL</em> riboswitch this results in…
3683 The microorganisms in which group are the first colonizers in an acid mine and what integral early f…
3690 A major difference between transformation and conjugation is that&nbsp;…
3692 Tube worms have a symbiosis with which kind of microorganism?…
3693 <i>Leptospirillum</i> sp. are found in the acid mine. Select all of the following that are true.…
3694 You have been tasked with classifying a&nbsp;recently discovered lake. The water present&nbsp;is ver…
3695 The dominant bacterium in lake environments are from the ac1 lineage and the dominant bacterium from…
3700 Which of the following characteristics of microbes in&nbsp;mines contribute to the toxicity of acid …
3703 Ammonia-oxidizing bacteria, nitrite-oxidizing bacteria, and aerobic methane oxidation all share one …
3705 Which of these options is a correct difference between&nbsp;aerobic methane oxidation to anaerobic m…
3706 If there was a mutation in the <em>luxI</em> gene such that it was no longer functional, what would …
3707 A sample of soil microbes is being grown under anaerobic conditions and you have determined that the…
3708 The deep sea has been found to be home to multiple different microorganisms. <em>Geoglobus ahangari<…
3709 You have put a lot of work into purifying a cell culture of <em>Streptococcus pneumoniae</em>. To en…
3710 How do cells ensure that each daughter cell will get a plasmid?…
3711 Plasmids use a toxin-Antitoxin system, which is a linked gene that encodes for two proteins. If the …
3712 Which one of the&nbsp;physiology of acl-B1 is correct?…
3713 If a&nbsp;strain of <i>E. coli</i>&nbsp;had a mutated <em>lac</em> operon such that the&nbsp;LacI ge…
3718 What happens to the&nbsp;<em>lac</em>&nbsp;operon when lactose is <strong>NOT</strong> present and g…
3724 Why is culturing of microbes currently not an effective way of learning what is in an environment?…
3727 Which of the following is a selection?…
3729 Which statement is true regarding horizontal gene transfer via transformation?…
3731 What type of Eukaryotes grow and live in acid mines?…
3732 What is not a major group found to be present in acid mines?…
3738 Identify the correct paring between the lakes type and it&rsquo;s corresponding nutrient level:…
3741 What is true about induction?…
3744 Which of the following is the most abundant primary producer in lakes?…
3745 A species of bacteria is able to freely take up DNA from its environment. Which of the following for…
3746 You have found two unknown microbes that behave identically in growth tests. However, other investig…
3756 A aberrant T cell that cannot be activated is isolated from a patient. Experiments performed on this…
3757 Select the correct statement regarding Koch&#39;s postulate:…
3758 What role do MAMPs play in the immune system?…
3759 A bacteriophage kills all the <em>Staphylococcus epidermidis</em> on your skin. The loss of this bac…
3762 <em>Danio rero</em> fish ( Zebrafish) have developmental abnormalities when raised in a germ-free st…
3763 What is a major difference between macrophages and neutrophils?…
3764 An activated cytotoxic T-cell (CD8+) recognizes a viral antigen in an MHC I molecule. The T-cell wil…
3766 What factors of gut microbiota promote weight loss?…
3768 You are a physician who has in-depth knowledge about the gastrointestinal tract. When looking at one…
3769 In hemorrhagic <em>E. coli</em> its virulence factors include…
3770 In the blood stage, this microbe attaches to, and then grows inside red blood cells.…
3771 The pandemic strain of influenza that hit the US in 2009 was caused by a mixing of bird, pig, and hu…
3772 Which of the following is not part of Koch&#39;s postulates?&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;…
3775 Which of the following are steps in water processing? Check all that are correct.…
3776 You have a patient with bacterial pneumonia caused by Gram-positive cocci. Your first choice of anti…
3777 A new bacteria&nbsp;has the ability to kill any dendritic cells it encounters in its host. This will…
3778 Which of the following statements is TRUE regarding CD4+ and CD8+ T cells?&nbsp;…
3784 What is <strong>not true</strong> of rhinovirus infection?…
3786 Which of the following is not true about MHC I presentation?…
3789 Select the following statement that is NOT true about Rhinovirus:…
3790 If you think about reservoirs and carriers..…
3792 Which of the following is <strong>not</strong> an example of a role&nbsp;an opsonin can play?…
3794 Which of the following statements about skin as a barrier to infection is <strong>FALSE</strong>?…
3795 Which of the following statements about the differences between exotoxins and endotoxins is <strong>…
3797 What is the role of the bacterial symbiont in the Beewolf Digger wasps?…
3798 Which of the following is FALSE about <em>B. burgdorferi</em>?…
3801 Dysbiosis of the gut microbiota is believed to play a role in which of the following disorders:…
3802 Which of the following diseases are caused by viruses?…
3803 Key characteristics of CD4 and CD8 cells include:…
3805 Why would fusion inhibitors be an effective treatment for HIV?…
3806 The difference between probiotics and prebiotics is...…
3807 _____ is the type of antibody that makes up _______ of total antibody in serum. This antibody can ac…
3808 What is false about <em>C. difficile</em>?…
3809 Which of the following was <strong>NOT</strong> shown by&nbsp;the mouse diet experiment?…
3811 Which of the following regarding <em>Staphylococcus aureus</em> is false?…
3815 What is the activity/role that is specific to opsonins…
3816 Which of the following are associated with innate immunity&nbsp;…
3817 Which of the following diseases should you not treat with antibiotics due to the release of Shiga to…
3818 Match the microbial symbiont with correct the host and role.…
3820 Which of the following is not a way that microbes become resistant to antibiotics?…
3822 Which role is not typical of mutualistic microbes?…
3823 What is a difference&nbsp;between primary and secondary symbionts?…
3825 Which of the following describes the complement protein C3a? (Select all that apply)…
3828 What is some evidence that shows that each person has their own particular microbiota? Select all th…
3829 Which of the following is <strong>INCORRECT</strong>. Our body fights microbial infection by...…
3830 What step did John Snow NOT take to identify the source and end the Cholera outbreak in London?&nbsp…
3831 Which of the following has helped decrease the transmission of disease?…
3832 Dendritic cells are present in the…
3833 What is <strong>not</strong> a function of dendritic cells?…
3835 What steps can individuals take to control the COVID-19 pandemic? (Check all that are correct)…
3836 Your friendly neighborhood dentist passes out baby carrots every year for halloween instead of candy…
3839 How does fermentation affect community physiology during anaerobic degradation?…
3841 Which is false about HPV?…
3842 What bacteria is inversely correlated with body mass and the severity of appendicitis? …
3843 Through various methods, microbes can become resistant to antibiotics. Select all of the following w…
3845 Which of the following environmental conditions&nbsp;would result in the highest efficiency of metab…
3846 Bacteria species A undergoes a normally unfavorable reaction in its metabolism, but bacteria species…
3848 Which type of vaccine injects a living pathogen and raises an immune response?…
3851 Acetogenesis will dominate in an environment...…
3853 Match the immune cell to&nbsp;one of its functions…
3854 Which of the following is an example of an exotoxin paired with the correct way it damages a host?…
3855 The difference between Methanogens and Acetogens is...…
3856 What are the benefits of <em>Staphylococcus epidermidis</em> on skin.…
3857 Which of the following is <strong>NOT</strong> true regarding the action of the toxins in <em>C. dif…
3858 Which of the following is a&nbsp;correct characteristic&nbsp;regarding&nbsp;the skin as a barrier to…
3861 Which of the following is NOT a reason why skin acts as a barrier to microorganisms?…
3862 What is the main difference between MHC I and MHC II?…
3863 How does the microbiome impact weight gain?&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;…
3864 Which species&nbsp;of <em>Plasmodium</em> is the biggest problem to humans due to it having no prefe…
3867 Which of the following is <strong>NOT</strong>&nbsp;a&nbsp;characteristic&nbsp;of the acetyl-CoA pat…
3869 One week after taking a long hike&nbsp;through the woods you develop a fever, general malaise and no…
3870 Which of the following about flavonoids are true?…
3871 Which of the following did not decrease the incidence of infectious disease?&nbsp;…
3872 You discover a new microbe living in a hydrothermal vent. You shine a UV light on the slide containi…
3873 Which of the following is <strong>FALSE</strong> about&nbsp;<em>Staphylococcus epidermidis</em>?…
3876 In an anaerobic environment with low levels of CO<sub>2&nbsp;</sub>and low levels of SO<sub>4</sub>,…
3877 Which of the following is <strong>false</strong> about flavonoids and the human microbiome?&nbsp;…
3881 What is the function of a type 3 secretion system?…
3886 Which of the following is not a factor that plays a role in antibody diversity?…
3887 What is a reservoir?…
3890 <br /> The enzymes Amylase employs water to breakdown which kind of molecular bonds?…
3891 Lactase is commonly used to alleviate symptoms of ... …
3892 The enzyme alpha-amylase is useful in breaking down which polysaccharide? …
3894 A research lab has developed a new antibiotic similar to penicillin. This antibiotic would be most e…
3895 When this enzyme has low activity in humans, cancer and cardiovascular diseases are likely to occur.…
3896 What bacteria do all cheeses being made rely on to finally make it to the form that everyone enjoys?…
3897 Streptokinase is a useful treatment for…
3902 Papain is found in...…
3904 Lipase can be used for…
3905 Which of the following prevents oxidative damage by&nbsp;regulating hydrogen peroxide at a cellular …
3906 In his TED talk, Rob Knight mentions that Cesarean, or C-section, births may lead to greater risk of…
3907 The ENS&nbsp;... (select all that apply)…
3908 What is the main difference between ATP and NADH?…
3910 Which of the following would NOT be an example of fermentation?…
3911 A major difference between photophosphorylation and oxidative phosphorylation is:…
3912 An increase in entropy of a reaction results in...?…
3915 Which of the following uses a membrane and proton gradient to generate ATP, but does not have reacti…
3916 You are making a batch of cheese using a starter culture. You’ve noticed a lot of bubbles have forme…
3918 What starter culture is added to Kim chi (a vegetable food staple in Korea) in order for the ferment…
3920 Which of the following is not true of a physical agent used to control and limit microbial growth?…
3921 Which of the following is true about the role of cytochrome Oxidase in the electron transport chain?…
3922 What is the generation time of a microbe population if the population is 2x10<sup>7</sup>&nbsp;CFU/m…
3924 Which of the following explains why some organisms cannot survive in the presence of oxygen?…
3926 What is the most effective way to eliminate the greatest possible number of microbes?…
3927 How does nematophila bacterium help nematodes?…
3928 The fermentation progression of chocolate relies on multiple types of bacteria. Which statement accu…
3930 A microbe that uses organic compounds as a carbon source, organic chemicals as an electron source, a…
3932 In your research lab, you isolate an unknown bacteria.&nbsp;After performing some experiments, you f…
3933 Which molecule is oxidized in this redox reaction?</p> <p>C<sub>6</sub>H<sub>12</sub>O<sub>6</sub…
3936 Select all of the following that are true…
3937 Which outcome is most likely to occur when transplanting a HFD dieted mouse&#39;s microbiome into a …
3941 In general, the difference between the effect of high temperature above the growth range of a bacter…
3944 Which one of these is a macronutrient…
3945 What is the symbiotic relationship that Rhizobia has with its host?…
3946 What are aphid diets missing that the bacterium <em>Buchnera aphidicola&nbsp;</em>produces for them?…
3947 Which of the following is not the function of&nbsp;<em>Lactobacillus acidophilus</em> in its partner…
3949 Insect hosts of endosymbionts cannot survive if their endosymbiont is lost.…
3950 Zooxanthellae provides which essential components to Coral for photosynthesis?…
3953 Which of the following forms of regulation is not utilized by the<em> trp</em> operon?…
3954 For your research, your team travels to southern Minnesota where there is a lot of farmland. You fin…
3955 You have a bacterium, <em>Goldy dooficus, </em> that makes a toxin, BadG, which causes people to roo…
3956 Which is the correct&nbsp;classification of an oligotrophic lake?…
3958 What is the source of energy and the source of carbon for microbes that are living in acid mines?…
3960 Which of the following explains how lake mixing occurs?…
3961 Which of the following is <em>FALSE</em> regarding Quorum sensing in Gram-positive bacteria?…
3962 One of the primary differences between transduction and transformation is that...…
3963 One of the primary differences between a selection and a screen is that...…
3967 Which one of the following is False about two-component regulators?…
3969 Which of the following bacteria causes diarrhea?…
3970 The gut would appear to be one of the prime spots for microbe invasion and infection of our tissues …
3971 Which is not an example of Host-Microbe Interaction?…
3972 Which of the following are NOT the virulence factors the pathogen,&nbsp;<em>Borrelia Burgdorferi, </…
3973 While hiking on a near by trail, you notice some unique looking flowers just off the dirt path. You …
3975 Which of the following correctly identifies the chemoattractants for phagocytes as well as&nbsp;thei…
3976 Which of the following is an implication of the large genome of SARS-CoV-2?…
3977 One of the primary differences between the catabolic processes of methanogens, acetogens, and sulfat…
3988 What protein complex in the cytoskeleton is important for cell division?…
3989 Where are ribosomes found in prokaryotic versus eukaryotic cells?…
3990 Which of the following would you expect to find only in Gram-positive bacteria?…
3991 Which is NOT a correct description of molecular structures of lipids, LPS, amino acids, sugars and n…
3993 In a lysogenic infection…
3994 You monitor a&nbsp;Lytic&nbsp;Virus, you know it is a dsDNA virus and causes the cell to lyse at the…
3995 Which disease did Edward Jenner, a British doctor, successfully prevent, and what method did he use?…
3997 The characteristics that all cells share are… (choose all that are correct)…
3998 The use of ATP is unique to which transcription termination method?…
3999 What are the differences in cell wall composition&nbsp;between Archaea and Bacteria?…
4000 Which of the following answers are true for both Archaea and Eukarya RNA polymerase(s)? …
4002 What is a key feature of Archaea?&nbsp;…
4003 What bacterial lineage is responsible for the food production of cheeses, beer, kombucha, and more, …
4004 A possible reason for Woese settling on 16 S RNA for constructing phylogenetic&nbsp;trees could be b…
4007 What is the difference between active transport and facilitated diffusion? (Select all that are corr…
4009 Match the role of the microbe with its corresponding category of impact.…
4012 in Rho-independent termination present in bacteria, what causes the RNA&nbsp;polymerase to cease tra…
4015 What is the special problem of (-) single stranded RNA viruses?…
4016 A new organism is found in Lake Mendota. It seems to have the same structures as bacteria, but there…
4019 Which of the following letters represents the promoter of a prokaryotic gene?</p> <p>&nbsp;</p> …
4022 All cells have...…
4026 Which attribute would an accurate phylogenetic tree use to classify microbes…
4028 Number 4 in the figure shown below is pointing to...<img alt="A cartoon of a typical bacterial cell.…
4031 Which of the following structures are found in most Gram-positive and Gram-negative cells? (Select a…
4032 Inclusions, located in the cytoplasm, tend to be species specific and provide a variety of different…
4034 Microbes utilize pili structures to aid in movement. Which of the following is the correct matching …
4035 In France, there was souring of wine and many people did not understand&nbsp;why this was happening.…
4036 What is the correct order of a virus's life cycle?…
4037 What major scientific advancement did Walter and Angelina Hesse discover for the world of microbiolo…
4040 Lipopolysaccharide (LPS) is</p> <p>&nbsp;</p> <p>&nbsp;…
4043 Antony van Leeuwenhoek contributed to the field of microbiology due to his advancement of...…
4046 Which of the following do Bacteria and Eukarya NOT have in common?…
4047 Using the genetic code table, translate the given codon sequence of a gene into its corresponding am…
4048 Which of the following, if <strong>absent</strong>, would prevent the process of <strong>DNA transcr…
4052 Which of the following provides evidence for the endosymbiotic theory in eukarya? …
4055 Prions are pathogenic agents that can cause neurodegenerative disorders. What mechanism causes such …
4057 Properties of a Gram-Positive cell envelope include…
4058 If a cell&rsquo;s Type IV pili are nonfunctional, which form of movement will the cell become unable…
4061 Which of the following characteristics&nbsp;is unique to <strong>only</strong> bacteria?…
4062 In bacteria, capsules and slime layers are best described as forms of...…
4065 Cell wall structures are different in Archaea vs. Bacteria. Which of the following examples are foun…
4066 If you take a naked ds DNA virus and move it into the cytoplasm of its host. It can often create vir…
4067 Molecular chaperones…
4068 Which of the following features is unique to each type of Bacteria/Archaea?…
4069 What makes carotenoids efficient in quenching triplet state chlorophyll?…
4070 Which is the most effective way to make a reaction proceed towards the products?…
4071 Which of the following are characteristics of chlorosomes?…
4072 Which is the most effective way to make a reaction proceed towards the products faster?…
4075 One way bacteria can avoid predation is by becoming filamentous; this prevents protists from consumi…
4077 Fermentation is&hellip;…
4078 Recently at your brewery, beer batches have been failing. Analysis shows that your beer has an alcoh…
4079 β-oxidation catabolizes _____________ prouducing ____________ and ____________…
4080 Light-harvesting complexes (LHC) focus collected photons onto…
4081 If you compare the electron transport chains of green bacteria, purple bacteria, and cyanobacteria t…
4082 A researcher is studying the growth rate of a bacterial culture.&nbsp; If the researcher wanted to c…
4083 <em>Lactococcus lactis</em> requires guanine to be present in any medium for it to be able to grow. …
4084 You are studying a bacterium that grows by filamentous growth and creates a biofilm in the bottom of…
4085 What does the food industry NOT do to chemically control microbes?…
4086 When <em>E. coli</em> begins to starve for nutrients it will.…
4087 Biocides are different than antibiotics because they generally damage DNA and proteins, while antibi…
4092 You decide to ferment beer and accidentally&nbsp;added double the starting amount of&nbsp;sugar in y…
4093 Match the method used to control microbial growth to its defining feature.…
4094 A newly discovered bacterium is isolated and grown in both aerobic and anaerobic conditions. The str…
4095 You have created a non-heat-sensitive medium, but you think one of you lab partners has contaminated…
4096 When comparing the TCA cycle and Beta-Oxidation, which of the following is a difference between the …
4097 Which of the following events does NOT occur during retinal-based phototrophy?…
4099 What distinguishes the light harvesting complex&nbsp;of the purple bacteria compared to the&nbsp;gre…
4100 Which of the following proteins is&nbsp;involved in&nbsp;guiding&nbsp;FtsZ to identify the center of…
4101 Which of the following will provide an accurate measurement of&nbsp;only live cells?…
4102 Which of the following is NOT&nbsp;a way for chemical biocides to kill microorganisms?…
4105 <em>Flectobacillus</em> spp. uses morphological plasticity to survive against&nbsp;its predator <em>…
4106 You brewed a batch of beer yesterday, but when you poured yourself a glass you noticed it tasted sou…
4107 How does ATP Synthase generate ATP using a proton gradient?…
4110 Which of these options correctly classifies the nutrient&nbsp;and identifies its&nbsp;function?…
4111 Trace elements in the cell can best be described as…
4112 Biocides are used in many different industries to nonspecifically target and remove organisms. They …
4113 A microorganism is trying to avoid being killed by a predator. Which of the following could be used …
4114 In this order: energy, carbon, and electron. What are&nbsp;a&nbsp;photoautotrophic lithotrophs sourc…
4116 Which of the following is a difference between anaerobic respiration and aerobic respiration?…
4117 A new microbe was discovered in a research lab at UW Madison. The researchers found that the microbe…
4119 Homofermentation and Heterofermentation are two distinct processes of fermentation that bacteria use…
4122 Retinal-based phototrophy is dependent on?…
4123 Why are trace elements important if we do not need a large amount of them?…
4125 Why is ATP used to phosphorylate glucose&nbsp;at the start of EMP glycolysis, and is it substrate-le…
4126 When comparing the photosystems of green bacteria, purple bacteria and cyanobacteria what are some c…
4127 Nutrient starvation can cause microbes to react in which of the following ways.…
4128 Match the situation with the method for controlling bacterial growth.…
4129 Match the tier of elements to their real-life example based on abundance, source, and ability to be …
4130 Which of the following is NOT a redox reaction?…
4131 Which of the following are ways microbes may react to starvation?…
4132 A speciailzed pair of chlorophylls exists at the reaction center. What is the key element present in…
4133 What functions does the membrane serve in the electron transport chain?…
4134 Hibernation is a response to starvation in some cells that sense&nbsp;change&nbsp;during entry to th…
4136 Within the cell membrane, there is a chain of electron carriers: one that reduces cytochrome c (254 …
4137 What is positioned next to the pair of chlorophylls in the reaction center in order to react with ch…
4139 How do biocides affect microogranisms?…
4140 What does <em>E. coli </em>do when they sense impending nutrient limitation?&nbsp;…
4142 In what order do microbes promote the fermentation of Kimchi? (first to last)…
4145 Which of the following are electron carriers? (select all that apply)…
4146 An organism grows anaerobically, uses light as its energy source, carbon monoxide as its carbon sour…
4149 Which of the following is true of catabolic pathways?…
4152 Possible roles of carotenoids are to...</p> <p>&nbsp;</p> <p>&nbsp;…
4154 Which of the following is correct about the difference between homofermentation and&nbsp;heteroferme…
4155 One major difference between purple and green bacteria is:…
4157 What phase(s) on a bacterial growth curve is/are used in the calculation of the growth rate?…
4158 Aerobic and Anaerobic respiration are categorized by whether or not they use oxygen or some other mo…
4159 Which of the following would increase the favorability of a reaction? (select all that are correct)…
4160 Biocides kill micro-organisms by&nbsp;…
4162 Which&nbsp;feature of the photosynthetic process does NOT distinguish&nbsp;the cyanobacteria from&nb…
4163 To prepare fruit for shipping it is common practice to&nbsp;use....…
4167 Which of the following statements are true about starvation reactions?&nbsp;…
4170 Which of the following are functions of magnesium?…
4171 In this redox reaction, what is change in electron potential?</p> <p>2H2+O2 -&gt; 2H2O</p> <p>…
4174 What might cause of the accumulation of acetaldehyde during the process of beer fermentation?…
4176 The bacterial cell uses succinate as it&rsquo;s carbon and electron source. It also uses light as it…
4177 A small molecule binds to a repressor, activates it, and ultimately stops transcription. What is the…
4178 The <em>trp</em> operon is regulated by a number of different mechanisms of regulation. These mechan…
4179 Which of the following is a difference between the cell&rsquo;s response under heat shock versus und…
4180 The main difference between a chromosome and a plasmid is…
4181 When adenine is not present in the riboswitch for the ydhl gene, what happens?…
4182 Match the RNA regulation concepts to their correct definitions.&nbsp;…
4186 You mutate a culture of <em>E. coli</em> such that it expresses resistance to rifampicin. Which of t…
4187 Why is manual culturing of microbes NOT an effective way of understanding what is in an environment?…
4190 The genes of the <em>lac</em> operon encode proteins needed for lactose metabolism in <em>E. coli</e…
4191 A deletion mutation of the <em>trp</em> operon repressor (trpR) would…
4194 Why was it difficult to isolate <em>Pelagibacter unique</em>?…
4196 Bacteriorhodopsin undergoes a conformational change within the membrane to:…
4198 What are the major products under anaerobic conditions with no SO<sub>4</sub>?…
4199 What happens when the auto-inducing peptide (AIP) concentration is high outside the cell and the cel…
4200 <em>Vibrio fischeri</em> is a species of bacteria that is capable of bioluminescence. Quorum sensing…
4202 Prochlorococcus is a cyanobacteria that is able to grow in oligotrophic regions at low light and dee…
4203 Match the various parts the the CRISPR Cas9 system to its proper function for editing a gene.…
4205 The maltose operon is regulated by the maltose activator protein, MaIT. Why is this protein required…
4207 What is the key difference between the degradation of cellulose in aerobic conditions versus anaerob…
4208 A strain of bacteria is mutagenized in hopes of producing higher levels of vitamin B12, the culture …
4209 If an intercalating dye mutagen is present within a strand of DNA that causes the insertion of an ex…
4210 What is the proposed metabolic physiology of ac1-B1?…
4211 What differentiates <em>Geoglobus ahangari </em>and <em>Thermococcus atlanticus</em> species found i…
4212 Which of the following accurately describes Sanger Sequencing?…
4214 Lake Mendota can be described as a Eutrophic lake. Which of the following best describes an Eutrophi…
4220 What characteristics does an oligotrophic lake have?…
4221 Your friend tells you that the lake next to your house is oligotrophic. You know that it is an oligo…
4226 Which of the following correctly describes <em>Geoglobus ahangari</em>, a deep sea ocean vent microb…
4228 Which process best describes how biopolymers are degraded<u><strong> anerobically</strong></u>?&nbsp…
4230 Some soil organisms are able to break down complex bio-polymers such as lignin. How is lignin degrad…
4231 How does the synthesis of the leader peptide affect the regulation of Trp?…
4233 Which of the following best describes the CRISPR Cas9 system and its use in gene editing?…
4236 You want to get a detailed survey of the microbes and their genetic information within a soil sample…
4245 What is the most common species of <strong>Archaea</strong> found in acid mines? …
4247 Which of the following is NOT a characteristic of both Prochlorococcus and Synechococcus?…
4249 In attenuation in the<i>&nbsp;trp</i>&nbsp;operon when Trp is in excess:&nbsp;…
4253 Which of the following regulation mechanisms does the&nbsp;<em>trp&nbsp;</em>operon not utilize?…
4254 LacI is a _____ regulator, while CAP is a _____ regulator.…
4256 Lignin is a polymer that is reduced to phenolics by . . .…
4258 Which of the following biopolymers would be most beneficial for the growth of ac1-B1?…
4259 In what environment do <em>Pelogibacter ubique</em> grow and what is a specific requirement for this…
4265 You are trying to identify if a specific foodborne pathogen is present in food in a quick and effect…
4266 Where do the primary producers in acid mines mostly obtain their carbon source from?…
4267 Eukaryotes found in acid mines…
4271 Which is/are true if there is a high cell population of <em>Vibrio fischeri</em>?…
4279 Why do so many deep sea organisms use inorganic materials for metabolism?…
4284 There is an environment with little sulfate&nbsp;in it. What is the most likely product of the anaer…
4285 Match the immune cell to the correct description.…
4286 Which cytokine is correctly matched with its effect during the innate response?…
4287 Rhinovirus&hellip;…
4288 Which of the following answer choices correctly describes the relationship between phylotypes and a …
4289 A newly discovered pathogen is able to survive prolonged periods on physical objects and then transm…
4291 Hydrogenotrophic methanogens reduce _______ into _____ and ______ to carry out&nbsp;methanogenesis.…
4293 Which of the following diseases is transmitted by airborne droplets?…
4294 Your elderly patient at the nursing home has contracted&nbsp;<strong><em>C. difficile</em></strong>.…
4299 Microbes tend to have a symbiosis with other microbial species in which the products of one reaction…
4300 Which is a true statement about the mechanisms&nbsp;of Prions?…
4305 Which of the following&nbsp;cannot be reduced to methane in&nbsp;methanogenesis?…
4306 You are investigating the gut microbiome composition in patients with different inflammatory bowel d…
4307 A major difference between B-cells and T-cells is that...…
4308 Suppose you wanted to vaccinate a population against a certain infectious disease, but some of your …
4309 If an individual does not have an ACE2 receptor they are unable to get infected by which pathogen?…
4310 Which of the following reasons explains why beta-lactam antibiotics do not work against&nbsp;<em>Myc…
4312 Which of the following accurately describes the process of methanogenesis?…
4314 Which of these is not something selected against during B-cell and T-cell maturation.…
4317 Which one of these is a reason&nbsp;that the skin is an effective barrier to microorganisms?…
4318 E. coli pathogens&hellip;…
4321 Which of the following accurately describes how T-cells sense that a host cell is infected?…
4322 <em>Syntrophomonas</em> oxidizes butyrate to acetate to make ATP. This process has a ΔG&deg; of +48.…
4323 As demonstrated by participants in the biggest loser reality TV show, keeping weight off is difficul…
4324 Examples of major phagocytic cells in the body include:…
4326 How is the MHC I antigen-presenting pathway different than the MHC II antigen-presenting pathway for…
4328 How has the incidence of disease been reduced?…
4329 Which of the following answers correctly corresponds to each type of toxin?…
4331 What does Azithromycin target?…
4332 The unique characteristic of Amensalism is:…
4333 What is the difference between the foregut chamber and the hindgut chamber within mammals that canno…
4335 What is a major difference between B cells and T cells?</p> <p>&nbsp;</p> <p>&nbsp;…
4336 John Snow investigated the outbreak of which disease in 1854, ultimately discovering that it was bei…
4340 Safe drinking water must have pathogens and other contaminants removed from it. The steps for this t…
4341 You are a super amazing scientist that just isolated new pathogen <em>Almostdone withfinals.</em><i>…
4343 What is the order of Koch&#39;s postulates? Rank them 1-4 with 1 being the first.…
4346 Zebra fish in&nbsp;a bacteria filled environment differ from zebra fish in a germ free environment b…
4347 What is the difference between macrophages&#39; and dendritic cells&#39; roles in antigen presentati…
4348 Match the antimicrobial secretion to its correct mode of action.&nbsp;…
4350 What is a true statement about Rhinoviruses?…
4351 The difference in mechanism&nbsp;between two common antimicrobial glycoproteins, transferrin and fib…
4352 What are some possible ways that microbes make themselves resistant to antibiotics? (select all that…
4355 Match the antimicrobial defense substance with the correct mode of action&nbsp;…
4358 Which of the following statements is correct regarding Koch&rsquo;s postulate?…
4359 How are T cells activated?&nbsp;…
4360 A complement activation pathway involves binding to a carbohydrate on a pathogen&#39;s surface via a…
4361 How does a component vaccine raise an effective immune response in order to protect people from dise…
4363 Which of the following are steps involved in the activation of B lymphocytes?…
4368 Endotoxins&hellip;…
4370 How did John Snow determine the cause of the London Cholera outbreak?…
4373 Methanogenesis is the process of reducing compounds to methane, with hydrogen often being the electr…
4374 Lipopolysaccharides on the outer membrane of Gram-negative bacteria can act as an endotoxin. How do …
4375 If a eukaryotic cell is capable of photosynthesis, it must have a……
4376 You isolate an bacterium growing in Mammoth Hot Springs at Yellowstone National Park. <img alt="Mam…
4377 A cell growing in a lake senses the nitrogen and phosphate concentrations decreasing, and it begins …
4380 Glucose Oxidase converts glucose into_____…
4384 Nisin is <strong>not</strong> present in which product/s?…
4385 When alcohol dehydrogenase comes into contact with alcohol, what intermittent product is metabolized…
4389 Glucose Isomerase can be used to create a reaction producing which of the following…
4390 When enzyme helps digest fats in our stomachs?…
4391 Rennet is most commonly used to make..... …
4393 What type of cancer is asparaginase used to help treat?…
4394 Which of the following is not an end product of heterofermentation?…
4395 Lactase is a useful treatment for...…
4396 A woman comes in complaining about her digestive issues. She is eating a lot more protein due to tra…
4397 Abnormally high lipase levels are associated with…
4403 <em>This</em> is a key enzyme found in Rennet. When <em>this</em> is introduced to casein proteins f…
4409 Cheese production is a process of complex milk fermentation. Which of the following steps is NOT a p…
4410 Nattokinase is currently undergoing further clinical trials to treat…
4416 Which LAB&nbsp;pathway results in the production of lactic acid, ethanol, and carbon dioxide?…
4417 DnaK, GrpE, and DnaJ are……
4418 The toxin-antitoxin system for plasmid maintenance involves…
4419 Bacteria have CRISPR systems to…
4420 When scientists first started investigating the environment by trying to culture bacteria, they foun…
4421 Quorum sensing in <em>Staphylococcus aureus</em> uses a two-component system to translate the concen…
4422 The primary colonizers of the teeth are:…
4423 A huge collection of microorganisms populates your gut. While they have many uses, your body still n…
4424 Obese individuals have a different Bacteroidetes to Firmicutes ratio and a lower Shannon Diversity I…
4425 How do the Protozoa microbes assist termites?…
4426 Can termites survive without Protoza microbes?</p> <p>&nbsp;…
4427 What are mycelial threads?…
4428 What fungus do the roots of plants often form a relationship with?…
4430 Approximately how many microorganisms are living in the human intestines?…
4432 In the relationship between&nbsp;<em>Riftia Pachyptila</em> and <em>Gammaproteobacteria</em>, what d…
4433 What does&nbsp;<em>Mycorrhizae</em> collect from its host plant?…
4434 What do sulfer-oxiding bacteria provide for their host, the deep sea tubeworm?&nbsp;…
4437 How many living microorganisms live in your intestines? …
4438 Breastfeeding can help reduce the risk of... …
4439 What kinds of threats are presented to the <em>Lagria villosa</em> Beetle&#39;s&nbsp;eggs?…
4440 How does the bacterium&nbsp;<em>Burkholderia gladioli</em>&nbsp;help the <em>Lagria villosa</em> Bee…
4441 <em>Mycorrhizae </em>protect plants from soil-borne diseases.…
4443 The cell membrane linkage types of archaea, eukaryotes, and bacteria are as the following:…
4444 In a bacterial cell that can no longer synthesize <!--anki--><meta charset="utf-8" />N-acetylmuramic…
4447 Which statements are traits of a lysogenic cell infection by λ bacteriophage?…
4453 What is an example of why&nbsp;Archaea and Eukarya are considered sister groups (more related), whil…
4456 Which of the following is true about Bacteria, Archaea, and Eukarya?…
4457 A major difference between saturated fatty acids (SFA) and unsaturated fatty acids (UFA) is that&hel…
4459 What types of cells&nbsp;contain diaminopimelic acid (DAP)?…
4460 What is a major difference between bacteriophage lambda virus and T4 virus?…
4462 If you think about the life cycle of a virus...…
4463 How do (-) ssRNA viruses replicate their genes in the host cells?…
4464 Which of the following is true about peptidoglycan?</p> <p>&nbsp;</p> <p>&nbsp;…
4465 Which of the following accurately describes the differences between a bacterial cell and a eukaryoti…
4466 Why might it be beneficial for a species of pathogenic bacteria to have a capsule?…
4467 Which of the following is a similarity between archaeal cells&nbsp;and eukaryotic cells?…
4468 What is one&nbsp;structural or molecular similarity that Eukarya and Archaea share that differs from…
4470 Which of the following is a characteristic of the RNA polymerase in both Bacteria and Archaea that i…
4472 A major difference between&nbsp;rho-dependent and rho-independent termination is that...&nbsp;…
4475 What determines if Bacteriophage&nbsp;λ is lytic rather than lysogenic?…
4477 How does peptidoglycan differ in Gram-negative and Gram-positive bacteria?…
4480 Traditional phylogenic classification methods classify organisms based on similar characteristics, l…
4481 Microbes have a large biological impact on our planet, and their uses can be applied to many differe…
4484 Which of the following contain the correct scientist with their accomplishment?…
4485 You&#39;ve come down with a bacterial infection days before your microbiology exam. Your doctor prec…
4486 Using the 5 RNA sequences provided, align the 6th listed sequence properly.</p> <p>&nbsp;</p> …
4487 Based on what characteristics are shared by extant species, which of the following characteristics d…
4490 At which point in it&#39;s life cycle does the Lambda Phage choose between lytic or lysogenic?…
4494 Which of the following is a major difference between rho-independent and rho-dependent termination?<…
4495 Given the options below, what makes the most sense for the function of the capsule in&nbsp;<em>Strep…
4496 Which option accurately explains the difference between how lysozyme and penicillin behave in the ce…
4497 Which of the following are characteristics of the viruses&nbsp;Qβ, T4, and lambda phage?</p> <p>&…
4498 Which of the following are characteristics of the viruses Qβ, T4, and lambda phage?</p> <p>&nbsp;…
4499 In bacterial transcription, the recognition of genes by RNA polymerase involves several key elements…
4500 What is a difference that separates Eukarya from Bacteria?…
4502 What is the difference between transcription promoters in bacteria and eukarya?&nbsp;…
4503 Which of the following is a major difference between the actions of lysozyme and penicillin on the c…
4505 What is a key difference between RNA and DNA?…
4506 Match the activity with its correlating step of the virus life cycle…
4508 <table border="1" cellpadding="1" cellspacing="1"> <tbody> <tr> <td>1</td> <td>G</td> …
4509 Molecular chaperones in protein synthesis...…
4511 When comparing Archaeal and Bacterial cell membranes, which of the following is true?…
4516 Which of the following is NOT found in a Gram-positive cell wall?…
4517 Robert Hook’s work involving microbiology was innovative for its time because …
4520 Angela and Walter Hesse discovered Agar as being helpful as a culture medium in the microbiology lab…
4523 What is the main difference between RNA viruses and DNA viruses?…
4527 Which protein is involved in bacterial cell shape?…
4528 What do Qbeta and T4 viruses have in common?…
4530 Phylogenetic trees are used in microbiology to infer relatedness and evolutionary background of micr…
4538 One major difference between Gram-positive and Gram-negative cells is:&nbsp;…
4539 You notice bubbling coming from the bottom sediment of a pond. You decide to try and light it with a…
4541 Why is it important that we study microbes (select all that apply)…
4543 In a triplet condon TAC, if it is accidentally mutated to TAA, what would happen to the protein sequ…
4547 Which of the following statements accurately describes a difference in the compositions of cell memb…
4548 Penicillin is often used as a way to destroy/inhibit peptidoglycan in the cell walls of bacteria. Th…
4549 What differentiates archaeal lipid side chains from bacterial and eukaryotoic lipid side chains?…
4550 Why do (-)ssRNA viruses carry replication proteins with them in the capsule and (+)ssRNA not?…
4555 Which&nbsp;cellular component is unique to bacteria and what is its function in bacterial cells?…
4559 Which of the following exists in both archaea and eukarya but not in bacteria?…
4560 A major difference between Rho-independent and Rho-dependent termination is that&nbsp;…
4561 Suppose an <em>E. coli</em> strain had a mutation that resulted in its flagella being unable to rota…
4567 What in Gram-negative bacteria causes the outer membrane to allow many molecules through?</p> <p>…
4569 Identify which of the following statements about evolutionary relatedness of organisms based on phyl…
4571 Gas vesicles are&nbsp; _______________ and function to ______________.…
4573 When considering peptidoglycan in Gram-negative bacteria...…
4574 What evidence would support the idea that mitochondria evolved from bacteria?&nbsp;…
4577 Upon drawing a depiction of a bacteria and eukaryotic cell, what must&nbsp;be included within both t…
4578 Which of the following are&nbsp;true about the structure&nbsp;of eukaryotic and bacterial cells?&nbs…
4581 The main structural difference between naked viruses and enveloped viruses is that…
4582 You discover a new virus and find that it carries the enzyme reverse transcriptase. What assumptions…
4584 How does horizontal gene transfer relate to the value of 16S&nbsp;rRNA&nbsp;in comparing evolutionar…
4587 Which of the following are traits of BOTH photosynthesis in purple bacteria&nbsp;and retinal-based p…
4588 Biocides work to control harmful substances by&hellip;…
4590 Which of the following best describes aerobic respiration?…
4591 What group of bacteria creates a chlorosome and what does it do?…
4592 The reaction center of a specific cell&nbsp;is missing the&nbsp;magnesium ion in the special pair of…
4593 Which of the following is a difference between anaerobic respiration and aerobic respiration?…
4594 What is the one of the ways that a proton gradient is created by cytochrome aa3 or electron carriers…
4595 Why are light harvesting complexes an important part of the process of photosynthesis? (Select all t…
4596 In chocolate, varying microbes are responsible for fermentation across the week-long process. Which …
4597 In Microbio 304, Microbiology of Organisms Laboratory, you are completing dilutions of an unknown wi…
4598 The cheese-making process relies upon which of the following?…
4600 You want to create a beer with a certain alcoholic percentage. But, when you are performing the stan…
4601 Which of the following bacteria are able to produce phycobilisomes?…
4603 Which of the following is true regarding light harvesting complexes?…
4604 Which of the following nutritional classifications match their corresponding definition?…
4606 MinE is absent in a cell. What is a plausible result of this?…
4607 If a microorganism has a cytoplasm with a pH of 10, we can conclude&hellip;…
4608 Given these two half reactions, which of the following is true?</p> <p>O2 + 4H+ + 4e- &rarr; 2H2O…
4610 Which of the following classifications&nbsp;of elements and molecules are correct? Select all that a…
4612 Chemical biocides are used in the oil/gas industry, specifically petroleum. Biocides help kill micro…
4616 You are given 2 readings from the log phase of a growth curve of &quot;A&quot; bacteria; the lower C…
4619 Which of the following is true about retinal-based phototrophy and the photosynthetic apparatus of p…
4620 Which of the following are ways the biocides impact microorganisms?…
4622 Magnesium is a ____ and one of its functions is to ______…
4625 Match the element/compound&nbsp;to Macro/micronutrients and the trace elements…
4627 In what ways does retinal-based phototrophy differ from photosynthesis?…
4628 The primary function of the F<sub>1</sub> subunit within ATP Synthase is to…
4629 Which of the following is a growth factor?…
4631 Oxygen is critical for ______ because it is required in their metabolism, while many ______ can stil…
4633 One similarity&nbsp;between the TCA cycle and the&nbsp;β-oxidation includes:…
4635 Chemical biocides</p> <p>&nbsp;</p> <p>&nbsp;…
4637 Which of the following can use H<sub>2</sub>S as a source of electrons for their electron transport …
4638 In ATP synthase, what conformation is the F1 beta subunit in when ADP and inorganic phosphate react …
4639 You are a microbiologist and you think you discovered a new species of green bacteria. The genomic s…
4640 There are several factors that limit growth within microbial communities. Which of the following gro…
4642 In response to nitrogen&nbsp;starvation, cyanobacteria will form&nbsp;…
4644 A microbe living in extreme heat temperatures is called a _________ and has adapted ___________ to s…
4645 A scientist just discovered a vial containing pathogenic microbes in his lab while cleaning up. With…
4647 Which is an effective method of controlling microbial growth using physical agents?</p> <p>&nbsp;…
4648 The phase of growth where exponential growth ceases, and the cell number remains the same is called.…
4649 The goal of all catabolic pathways is to generate energy, normally in the form of (select all that a…
4652 What roll do light-harvesting complexes play in photosynthesis?…
4654 A species of bacteria replicates by binary fission. After 8 generations, how many bacterial cells wi…
4655 A cyanobacteria cannot obtain the nutrients necessary for survival and is thus in a state of nutrien…
4661 Describe the mechanisms that the electron transport chain uses to move protons across the membrane. …
4665 Fermentation results in the accumulation of NADH within the cell. For fermentation to continue, the …
4666 Which of the following micronutrients are needed for ATP-Dependent reactions?…
4667 Match each of the traits to the correct&nbsp;method of&nbsp;controlling microbial growth using physi…
4671 In a lake environment, cyanobacteria suddenly become subjugated to limited&nbsp;environmental condit…
4675 An important protein involved in creating the proton gradient across the cell membrane is NADH reduc…
4682 Bucky Badger calculated the growth rate to be -1.129 from the following data. What appears to be wro…
4684 Which of the following reactions has the largest electron potential drop in MeV?<br role="presentati…
4692 Kim Chi&nbsp;is a delicious, Korean food that undergoes&nbsp;natural fermentation and involves many …
4701 How would a microbe that uses carbon dioxide as its carbon source, light as its energy source, and i…
4704 You and a friend have started brewing beer together. Your friend thinks you should try ultra-high te…
4705 What characteristic enables green bacteria to thrive in low-light, nutrient-deprived environments?…
4710 <span style="font-size:16px;"><span style="line-height:107%"><span lang="EN-US"><span style="line-he…
4712 Which microorganism plays a key role in the fermentation process of kimchi?…
4713 You have just isolated the genome of a new microorganism. You want to find out if it can make enzyme…
4717 When do <em>Vibrio fischeri</em> exhibit bioluminescence:</p> <p>&nbsp;…
4718 You are trying to investigate the complete microorganism composition in your living space and decide…
4721 What is true of bacterial diversity in acid mines?…
4722 By which of the processes below do the majority of microbes in acid mines&nbsp;obtain their carbon?…
4725 You wish to isolate a microbe that produces vitamin B12. Which of the following techniques would all…
4729 You want to determine what&nbsp;metabolites are being used in a sample of mud. What technique would …
4730 What type of lake is saturated with minerals and nutrients to the point where it has an overgrowth o…
4734 During which&nbsp;season does the major lake mixing event occur?…
4735 Which factor directly triggers a lake mixing event?…
4739 What is the most likely cause of the mutation shown below?</p> <p>&nbsp;</p> <p><img height="1…
4740 In order for transcription to occur in the maltose operon, which of the following events need to occ…
4744 During environmental stress, increased temperature, the RpoH concentration ____ because the molecula…
4746 Which of the following terms best describes a lake with lots of algae growth, numerous aquatic&nbsp;…
4749 Regarding acid mining, which of the following are correct?…
4752 What is a characteristic of plasmids?…
4758 In catabolite repression, which molecule binds to CAP, and what happens when it binds to CAP?…
4765 In catabolite repression of the lac operon, what role does glucose play?…
4766 Which of the following describe Eukaryotes in acid mine drainage?…
4767 Which of the following descriptions accurately describes how the fungi and protozoa grow in acid min…
4768 The gene that encodes the Autoinducing Peptide (AIP) is ...…
4770 In microbes, CRISPR and cas-proteins capture viral DNA. Where is this (viral) genetic code integrate…
4774 In community physiology, what is the role of depolymerization?…
4777 Select all that apply. Catabolite repression in the <em>lac</em> operon:&nbsp;…
4779 Two strands of circular genetic information are present in a cell. A scientist believes that&nbsp;on…
4780 <em>Thermococcus atlanticus</em> is an organism that gets its energy from the oxidation of organic c…
4782 Which of the following statements on&nbsp;<em>Vibrio fischeri</em> are true? Select all that are tru…
4784 Which of the following occur in Methyl Mismatch Repair? (multiple answers)…
4785 If you were to remove the protein IIAGlc from the PTS complex during lac operon regulation, what wil…
4786 Which of the following is true of <em>Nitrosomonas</em> sp. and <em>Nitrobacter</em> sp.?</p>   <p…
4788 Although there is some growth of microbes off of Dissolved Organic Carbon (DOC) in acid mines, most …
4789 Metabolomics is...…
4794 The isolation of <em>Pelagibacter ubique</em> included which type of medium?&nbsp;…
4796 Which of the following describes the symbiosis between the deep sea tube worm and sulfur-oxidizing b…
4798 Among which group are plasmids most prevalent?…
4799 In <em>Streptococcus thermophilus</em> what happens if CRISPR is effective at repelling the initial …
4802 How does the maltose activator protein increase transcription?…
4803 Which of the following is a major difference between chromosomes and plasmids?</p> <p>&nbsp;</p> …
4804 Which of the following characteristics is correct regarding microbes and chemical reactions within t…
4806 In lignin degradation...…
4810 You have a new microorganism that you have just isolated. You suspect your bacterium is capable of d…
4812 What type of bacterial feature acts like the human immune system?…
4813 You suspect your newly isolated bacterium is capable of degrading cellulose. Match the methods with …
4814 Which of these microbes could be found in a deep sea ocean vent community, growing on proteinaceous …
4817 Deep-sea tube worms are in a mutualistic relationship with sulfur-oxidizing bacteria. The benefit fo…
4818 _________ is the autoinducer in the <em>Agr</em> quorum-sensing system in Gram-positive bacteria (<e…
4820 Which of the following is a compound/element&nbsp;take up by&nbsp;tube worms&nbsp;found near deep se…
4822 The dominant bacterial species in an acid mine has Fe<sup>2+&nbsp;</sup>oxidized with..…
4823 You are using the FISH method to determine if a species is present in a certain environment. Describ…
4828 Match the&nbsp;<em>Agr</em> (accessory gene regulator) type with its function/role in&nbsp;Gram-Posi…
4835 The reductive Acetyl-CoA pathway reduces CO<sub>2</sub>&nbsp;to _____ and _____,&nbsp; to combine wi…
4836 Which of the options below best describes how lignin&nbsp;is degraded?…
4847 After a trip to picnic point, you grabbed some soil and brought it back to the lab so you could iden…
4849 Which of the following statements best describes the physiology of the SAR11&nbsp;microbial genus (<…
4851 The following reaction takes place in which step of the nitrogen cycle: NO<sub>2</sub><sup>-</sup> +…
4852 In what situations are HSP&nbsp;(heat shock proteins) present in the cell?&nbsp;…
4853 What is the best way to describe the relationship between tube worms and the bacteria inside of them…
4855 UV light often causes DNA damage, what specific mutation would it cause?…
4856 The trp operon is an example of...…
4857 What type of lake has an overabundance of nutrients and minerals and a high biological activity wher…
4858 Lake mixing occurs in the ____ and ____ seasons. This causes the oxygen concentrations and nutrients…
4860 A mutation occurs to a large section of DNA. If there IS a&nbsp;complementary strand _____ repair wi…
4862 For B-cells to fully mature, what must happen before they&rsquo;re released into the bloodstream?&nb…
4864 Which of the following cellular events greatly contribute to an increase in tissue temperature?…
4866 What genus of microorganism is most likely to be found in the mouth as a primary colonizer?…
4867 What did John Snow's investigation allow for the conclusion of?…
4868 The actinomycetes that grow on Beowolf digger wasps&hellip;…
4869 You see a commercial touting the consumption of lemon flavonoids for managing diabetes. Your friend …
4870 Which of the following is true regarding the presence of flavonoids in the human body? …
4871 Men who enjoy hunting are more likely to get Blastomycosis. You are trying to determine the reservoi…
4873 After a significant weight loss, it is difficult for individuals to keep off the weight because thei…
4874 Chronic Wasting Disease is caused by the prion protein. How can a protein cause an infectious diseas…
4875 Your dear aunt Beatrice made tuna salad for the picnic. Unknown to everyone, after she prepared it, …
4876 What are the first phagocytes recruited when a microbe dangerous to your health is noticed?…
4878 Which of the following is considered to be an example of a carrier?…
4880 What is one function of Staphylococcus epidermidis that makes it a useful part of its normal microbi…
4882 What macromolecule(s)&nbsp;would the pattern recognition receptor (PRR) on a monocyte recognize?…
4883 What role do cytokine 3a and cytokine 5a play in the classic pathway?…
4884 Match the microbial symbiont to what it does for the host.…
4886 Match the following anti-microbial secretions with their correct purpose.…
4887 _____, _____ and _____ are examples of phagocytes which play this role in the immune system ________…
4888 Which is a characteristic associated with the pathogen&nbsp;<em>Chlamydia?</em>…
4889 Why do HIV patients have to keep taking the HIV treatment even after the virus is no longer detectab…
4896 Which of the following are true regarding <em>Staphylococcus</em>?…
4897 How is a proton gradient created during acetogenesis?…
4900 Which of the following viruses would be categorized&nbsp;as an oncovirus?…
4902 A bacteria may develop resistance to an antibiotic if it has a...…
4903 Which of the following involves a correct description of a microbial partnership?…
4904 Which of the following correctly describes acetogenesis?</p> <p>&nbsp;</p> <p>&nbsp;…
4907 B cells undergo clonal expansion and create two cell types. What are they?…
4908 Weight gain is impacted by the microbiome because when a person consumes a high-fat diet, the amount…
4909 All of the following are ways in which vaccines protect people from disease except...…
4912 Consider <em>Plasmodium</em> sp.…
4913 Which of the following are beneficial functions of&nbsp;<em>Staphylococcus epidermidis</em>?…
4914 What correctly matches a general class of vaccine with an example of it? Select all correct answers.…
4915 You are outside and suddenly you are stung by a bee, but you are allergic to bee stings. Which type …
4917 Which of the following is true about EHEC (enterohemorrhagic <em>E. coli</em>)?<br /> &nbsp;…
4918 Which of the following is a common early symptom&nbsp;for SARS-CoV-2 (COVID-19)?…
4919 Which of the following are correct regarding Malaria?…
4926 How is chronic wasting disease transmitted between deer?…
4929 Which of the following microbes uses unique C1 carriers reduced by hydrogen gas in its metabolism to…
4932 Acetogenesis is a anaerobic process that generates acetate&nbsp;and ATP by...…
4933 Which of the following is true regarding endotoxins and exotoxins?…
4934 Prions (chronic wasting disease) are transmitted by…
4935 Which of the following are symptoms of a&nbsp;<em>C. difficile&nbsp;</em>infection?…
4936 What is the primary role played by the epithelial barrier in the body&rsquo;s immune response?…
4937 What molecular cues attracted the phagocytes to an area?</p> <p>&nbsp;</p> <p>&nbsp;</p> <p…
4938 Which of these characteristics correctly describe a reservoir?…
4940 What is&nbsp;the role of cytokines in TSST?…
4942 Which of the following is a common role of a neutrophil?…
4943 Which of the following cells matches the function…
4944 How could&nbsp;low to no&nbsp;colonization levels of the bacterium <em>Akkermansia muciniphila</em>&…
4945 The addition of <em>Akkermansia muciniphila</em> to the microbiome has been shown to reverse the unh…
4947 As the lymphocyte matures, antibodies and TCR diveristy is created by...…
4948 Which of the following pathogens inject effector proteins directly into host cells:…
4949 <em>Syntrophomas </em>bacteria oxidize butyrate to acetate to make ATP and generate hydrogen gas as …
4950 Your friend has <em>Chlamydia pneumoniae</em>, and like every college student, refuses to go to the …
4951 How do CD8 cells (cytotoxic T-cells) partner with MHC complexes to trigger an immune response?…
4952 Why does better sanitation decrease the incidence of disease?…
4953 What is true regarding the inflammatory role of a cytokine?…
4955 Match the antibiotic to their bacterial target…
4958 What is the primary purpose of antigen presentation by dendritic cells and macrophages in the immune…
4959 SARS-CoV2 enters the cell by first attaching to the enzyme receptor ______. The virus is then taken …
4960 In regards to phagocyte mechanisms to kill bacteria...…
4961 Another name for CD8+ T-cells is...…
4962 HIV is a deadly virus that is spread through contaminated bodily fluids and attacks CD4-expressing c…
4963 Which of the following correctly matches an&nbsp;antibody&nbsp;with its proper function.&nbsp;…
4964 There is a population the lactic-acid bacteria <i>Streptococcus gordonii, </i>a producer, that thriv…
4965 Which of the following substances functions by binding to bacteria and assisting in clearance by pha…
4967 Which of the listed complement proteins may be directly involved in activating the&nbsp;membrane att…
4968 In John Snow&#39;s experiment to isolate the source of a Cholera outbreak, what was the source of ou…
4969 Which is TRUE about a vaccine that can be used to prevent against measles?…
4972 In T and B cell maturation&hellip;…
4973 Which of the following pathogen behaviors is possible due to a type III secretion system?…
4975 Which of the following accurately describes the course of chlamydia in the body?…
4977 Upon the formation of the CoB- CoM complex, where does the electrons for this process come from and …
4980 Which of the following interactions is most important in stabilizing the overall double-stranded hel…
4982 RNA polymerases in archaea recognize the start site in transcription...…
4985 After discovering a new microorganism, you determine that its DNA can <u>only</u> be transcribed in …
4986 Match the person with their work in microbiology.…
4988 If the host cell&#39;s protease (FtsH) level is high, what would bacteriophage lambda do?&nbsp;…
4991 A scientist is interested in finding a&nbsp;type of DNA helicase that can withstand extremely high t…
4994 Which of the following molecules or structures do Gram-positive bacteria lack that provides Gram-neg…
4995 If a disease-causing agent is mostly inactive (does not grow) in the&nbsp;cell, which drug, penicill…
4996 Why is Robert Hooke important to Thonis Philipszoon (Anton&nbsp;von Leeuwenhoek)?…
4999 Different viruses have different life cycles but T4 has similarities to both&nbsp;Qβ and lambda phag…
5001 How does a virus remain undetected in a lysogenic infection?…
5003 Which of the following structures is found&nbsp;in a bacterial cell <strong>and</strong> <strong>not…
5004 What is the major difference between archaea cell membranes and bacteria cell membranes?&nbsp;…
5006 Which of the following is a characteristic unique to Eukarya?…
5007 Which of the following statements best reflects the relationship between organisms based on a phylog…
5008 Which of the following statements best describes the amphipathic nature of lipids and their role in …
5010 Which of the following is true for Archaea but does not apply to bacteria or eukaryotes?&nbsp;…
5012 Which of these scientists isolated the first extreme thermophiles (<em>Thermus aquaticus</em>) that …
5014 While observing various viruses, you notice a virus that contains nucleic acids, a capsid, and an en…
5015 Which of the following is true in the relationship between Archaea and Eukarya?&nbsp;…
5018 What best describes the composition of a ribosome?…
5019 Which of the following differentiates archaea from bacteria?…
5020 Which choice correctly supports the Endosymbiotic Theory that chloroplasts originate from cyanobacte…
5023 Compared to Archaea and Bacteria, Eukaryotes have...…
5024 <div class="question_text user_content enhanced" id="question_8106559_question_text">Many organisms …
5026 What characteristics about translation are specific to prokaryotes?…
5027 Which three basic functions of life are found in ALL microbial cells (microbes)?…
5028 A lab was trying to analyze a virus and found it to contain only&nbsp;DNA and proteins, what type of…
5031 Which one of these options correctly describes the rotary motion that occurs in flagella in <em>E. c…
5033 T4 is a virus that regulates when it expresses certain genes. It does this through:…
5034 Lipids that make up the cell membrane in Archaea differ from the lipids that make up the cell membra…
5036 What are the differences between RNA and DNA that make&nbsp;DNA used as the hereditary material?…
5037 What are the metabolic functions and contributions of gas vesicles and where are they primarily loca…
5042 Which of the following accurately describes the structure and function of peptidoglycan in bacterial…
5046 Which of the following is a difference between the structures of RNA and DNA?…
5048 What is the purpose of molecular chaperones in the synthesis of proteins? …
5052 Which of the following would be degraded in the presence of lysozyme?</p> <p>&nbsp;</p> <p>&nb…
5053 Robert Koch was responsible for which major contribution to the field of microbiology?</p> <p>&nb…
5054 What characteristics do all three&nbsp;Domains share in the Phylogenetic tree?…
5055 Which of the following are similarities between RNA polymerase in archaea and bacteria?…
5058 A main difference between rho-independent and rho-dependent termination is that…
5059 Protein synthesis occurs in which organelle in eukaryotic cells?</p> <p>&nbsp;</p> <p>&nbsp;…
5069 A major structural difference between the Gram-positive and Gram-negative cell wall is...</p> <p>…
5070 Who did Edward Jenner first inoculate and what did he inoculate them with?&nbsp;…
5075 Which of the following are correct when considering the structure of lipopolysaccharide? (Select all…
5078 Compare the cytoplasmic membrane and the slime layer of a bacterial cell and choose which answer cho…
5081 Type I pili and Type IV pili differ in that ____.…
5082 Why did&nbsp;variolation of smallpox still have a 1% to 2% mortality rate which is high by todays st…
5084 How do cytoskeleton proteins contribute the stability of a bacterial cell?…
5085 A similarity&nbsp;between archaea and eukaryotes is they both have&nbsp;…
5086 How can prions be infectious?…
5089 Which of the following is not an ingredient in making beer?…
5090 Compare β-oxidation to the TCA cycle. Which of the following statements is true? …
5091 What bacteria are responsible for the first step of Kim Chi fermentation that ferments sugar to acid…
5094 When operating an autoclave&hellip;…
5096 One way microbes cam avoid predators is…
5098 Purple bacteria make a better experimental model for understanding photosynthesis than green bacteri…
5099 What is the difference between the retinal-based phototrophy and the photosynthetic apparatus of pur…
5100 Match the major growth limiting factors&nbsp;with&nbsp;the adaptations used by microbes to combat th…
5102 Which of the following is most likely to cause the solidification of the cell membrane and decreased…
5103 Which of these is options is&nbsp;a major difference between oxidative phosphorylation and photophos…
5104 There are many ways in which microbial populations are kept in check, which of the below factors wou…
5105 What are the three ways microbes respond to limited nutrients in their environment?</p>   <p> …
5106 During fermentation NAD+ is almost always ______ to NADH. Fill in the blank.…
5107 A green apple taste, or acetylaldehyde, can accumulate during beer fermentation in which of the foll…
5108 When dealing with temperature to remove microorganisms from a substance, the MOST effective manipula…
5110 What is the classification and example function of magnesium in the cell?…
5115 The growth of <em>Lactococcus lactis</em> requires adenosine for growth because it cannot make its o…
5119 Superoxide dismutase is an enzyme that is found only in...…
5120 Which method of control would you use to sterilize a plastic container for medical equipment?…
5121 Which of the following is&nbsp;unique to Green Bacteria compared to Purple Bacteria and Cyanobacteri…
5123 Compare the differences and similarities of the light-harvesting complexes of purple, green, and cya…
5124 The number of photons available limits photosynthesis.&nbsp;Light harvesting complexes helps maximiz…
5128 A major difference between Photosynthesis and Retinal-based Phototrophy is...…
5129 Which of the following best describes the link between the dissipation of the proton gradient and th…
5131 You are testing the growth rate of a sample of&nbsp;<em>E. coli&nbsp;</em>in a lab. You get&nbsp;a C…
5133 Which of the following oxidants would create an equilibrium in favor of reducing&nbsp;NAD to NADH?</…
5134 Which of the following are strategies that microbes utilize to protect themselves from predation? Se…
5137 What is true of the light-harvesting photosystems of purple, green, and cyanobacteria?</p> <p>&nb…
5138 What structure/s pump protons across the membrane&nbsp;in both photophosphorylation and oxidative ph…
5140 Which of the following could not survive in the presence of oxygen? (select all that apply)…
5141 Which is a difference between biocides and antibiotics?…
5142 Which starting material in the cellular respiration reaction is getting oxidized:</p> <p>C<sub>6<…
5143 Which of the following is true regarding the division of the cell?…
5144 If&nbsp;<em>E. coli</em>&nbsp;is in an environment where it runs out of carbon sources, how might it…
5146 When brewing a batch of beer, you find that your product tastes of bitter green apple. This was not …
5147 The Min system in <i>E. coli&nbsp;</i>is utilized by the cell in order to complete what process?…
5150 Which type of differentiated Cyanobacterial cell has the main purpose of fixing nitrogen, and how do…
5151 What type of structures are used in green bacteria to capture light, and what is the important subst…
5154 While trying to produce cheese, you discover that your curds are not knitting properly, and your res…
5155 A scientist identified two new important cellular reactions in bacteria: reaction 1: A+B&mdash;&mdas…
5157 Light harvesting complexes in purple bacteria…
5160 Which photopigment has&nbsp;the main job of&nbsp;quenching the triplet state of chlorophyll to preve…
5161 Which is an example of substrate level phosphorylation in fermentation?…
5164 What Physical Agent would be the used&nbsp;to sterilize glass pipets?…
5166 During the heat shock response, the level of heat shock proteins increases, one reason translation i…
5169 How do Sulfur-Oxidizing bacteria benefit tube worms in hydrothermal vents?…
5170 The major difference between the lac operon and the trp operon is...…
5172 How are plasmids maintained in bacterial cells?…
5173 How is it possible for the <em>lac</em> operon to have allolactose as the inducer when it is made fr…
5175 When asked to determine both the phylotypes present in a soil sample&nbsp;<u>as well as the metaboli…
5176 You are investigating a new operon that synthesizes ladderines. You find that the final product bind…
5177 Which of the following is <strong>NOT</strong> a characteristic of the reductive Acetyl-CoA pathway?…
5178 Which of the following are NOT properties of Pelagibacter Ubique's physiology?…
5179 A team of submarine scientists isolate several species of bacteria near a deep sea ocean vent. Which…
5180 What is&nbsp;denitrification and its significance?…
5182 Which of the following statements about the lux operon are&nbsp;<strong>true</strong>?&nbsp;…
5183 What is the main difference between a Plasmid and a Chromosome?…
5184 You take a soil sample and create a wet mount that you stain with DAPI (stains DNA).  Using the phas…
5185 Which of the following statements correctly contrasts quorum sensing mechanisms between Gram + bacte…
5186 In the mechanism of proteorhodopsin, the retinal……
5187 Which of the following is a major product of all kinds of metabolism under both aerobic and anaerobi…
5188 In which of the following situations would you <strong>not</strong> expect to find heat shock protei…
5189 Which of the following phylotypes were discovered by the Sorcerer II expedition?…
5190 Which&nbsp;characteristic&nbsp;of Ferroplasma acidarmanus, an archaea that is found in acid mines, i…
5191 Which of the following would you assign to a lake with low growth, low nutrients, clear water, and l…
5192 Mobile genetic elements are found in, …
5193 There is a double strand break in the DNA, but there are still both complementary strands. How would…
5194 Besides bacteria that can oxidize iron and/or sulfur compounds, eukaryotic species&nbsp;found in aci…
5195 What medium will Peligabacter ubique grow successfully in?&nbsp;…
5197 The&nbsp;<em>trp</em>&nbsp;operon includes a&nbsp;<em>trp</em>&nbsp;repressor protein that is&nbsp;s…
5198 You have a strain that produces vitamin B12 and secretes it into the growth medium. Which option wou…
5199 What is the primary role of Nitrobacter in the nitrogen cycle?…
5200 A major difference between the&nbsp;<em>T. atlanticus&nbsp;</em>and <em>G. ahangar</em>i species is …
5201 Lake Mendota has high biological activity and excessive nutrients like phosphorus and nitrogen. What…
5202 Which of the following activates the&nbsp;inactive repressor in the&nbsp;<em>trp&nbsp;</em>operon?…
5204 When comparing key processes of the nitrogen cycle, which of the following is strictly an aerobic pr…
5207 Color indicator plates are screens, not selection because.......…
5208 Which general group of microorganisms breaks down cellulose, chitin, lignin, and protein into smalle…
5209 Match the correct conditions with their role in cellulose degredation.…
5210 What is a&nbsp;difference between a plasmid and a chromosome?…
5212 Which of the following repair methods should be used to repair DNA modified by a frameshift mutation…
5213 Which of the following is true about transposons?</p> <p>&nbsp;</p> <p style="line-height:1.2"…
5215 What are some physical and chemical characteristics of deep-sea ocean vents?&nbsp;…
5217 Are chemoorganoheterotrophs found in deep sea ocean environments?…
5219 Which enzyme is specifically associated with the degradation of cellulose under anaerobic conditions…
5220 In the lac operon, what role does the repressor play when lactose is absent?…
5223 During the spring what would you expect to see in a lake?…
5224 In the reductive Acetyl-CoA pathway, where does the reducing power come from?|…
5225 You have a strain of bacteria that produces vitamin B12 and secretes it into the growth medium. How …
5228 Which of the following descriptions of the eukaryotes living in acid mines is correct?</p> <p>&nb…
5230 Which protein(s) of the <em>lux</em> operon synthesizes the autoinducer?…
5231 What is the difference between aerobic and&nbsp;anaerobic methane oxidation?…
5233 Which of these steps occurs in both gram-positive and gram-negative quorum sensing?…
5234 Your PI asked you to perform a transformation of your newly constructed plasmid pIA123 into competen…
5235 Which of the following techniques are NOT used in metabolomics?…
5239 You have just successfully isolated a new microorganism and you suspect it is able to degrade cellul…
5240 Are eukaryotic microbes found in acid mine drainages? If so, how do they grow?…
5242 What is a major difference between the <em>lac</em> operon and the <em>trp</em> operon?…
5243 Choose which of the following accurately completes this statement: The expression of the <em>lac</em…
5248 Which are accurate environmental characteristics of deep-sea ocean vents?…
5249 Which of the following molecules is specifically involved in quorum sensing in the Gram-positive bac…
5259 Which of the following could be considered a probiotic?…
5260 Pink eye is a common type of bacterial conjunctivitis that results in the whites of the eye turning …
5262 Which statement best describes the pathogenesis of <em>Clostridium difficile</em> infection?…
5263 What are the symptoms of inflammation? (4 correct answers)&nbsp;…
5264 What are&nbsp;B-lymphocytes role in the immune system?&nbsp;…
5265 What is acetogenesis?&nbsp;…
5267 Which of the following are true aspects of the&nbsp;<em>Akkermansia muciniphila</em>&nbsp;symbiosis …
5271 What microbes are present on human skin? (Select all that are correct.)…
5272 Match each symptom&nbsp;of inflammation to its cause at the cellular level.&nbsp;…
5277 A major difference between CD4+ T-cells and CD8+ T-cells is that...…
5279 Which of the following are considered phagocytes in the body? (Select all that are correct)</p> <…
5281 Which of the following is true of endotoxins and exotoxins?…
5283 Match the antibody to the correct function…
5288 Two of the major proteins found in the envelope of the influenza A virus are: (Select all that are c…
5289 Under a high-fat diet in mice, which of the following are true? Check all that apply.&nbsp;…
5290 How does the microbiota of an individual with a high fat diet differ from the microbiota of an indiv…
5291 If a healthy person&#39;s GI tract was colonized by a high-fat diet microbiome what would most likel…
5292 Phagocytosis is an important part of antigen presentation used by what cells?…
5294 A patient comes in complaining of severe abdominal pain that is accompanied by bloating and diarrhea…
5296 Which answer correctly describes how a vaccine protects you from disease?…
5298 What impacts the&nbsp;differentiation of phagocytes?…
5300 In methanogenesis, ____ only accepts electrons, resulting in a proton gradient…
5301 Which of the following are ways in which&nbsp;the skin is a barrier to microbes? (select all that ap…
5302 Which type(s) of antibacterial antibiotic target cell wall synthesis?…
5303 The following are characteristics of primary symbionts of insects:…
5304 A pathogen has entered a cut in your skin. Which of the following will lead to phagocytosis? Select …
5305 What is the role of opsonins?…
5308 Previously, we learned about Edward Jenner and his creation of the first vaccine for smallpox from c…
5309 The complement system is an enzymatic system composed of 9 proteins that&nbsp;help the body fight pa…
5311 Rank the following antigens by their strength in interacting with antigen-specific receptors on the …
5313 The large diversity of variable regions on T cells receptors and antibodies is created via:…
5317 Which of the following general classes of vaccines are matched up with the right immune response res…
5318 Which of the following is caused by dysbiosis in the gut microbiome?…
5319 How are antibodies able to diversify themselves to provide protection from the wide variety of patho…
5320 Penicillin&hellip;…
5321 A patient comes in with the following symptoms: abdominal pain, fever, vomiting, and bloody diarrhea…
5322 Which of these things are true of macrophages? (2 correct answers)&nbsp;…
5323 Which of the following are correct statements about the actions / targets of various antibiotics?…
5324 Which cell type plays a central role in initiating adaptive immune responses by capturing <strong>an…
5327 Which of the following is true about chlamydia?…
5329 The role of <em>Akkermansia muciniphila</em> in humans is:…
5331 Select the following options that are TRUE regarding microbes in the gastrointestinal (gut) tract</p…
5332 Describe the structure of the gut epithelium. What is the role of all the immune cells in gut health…
5333 Match the immunoglobulin class to its&nbsp;function…
5335 Which of the following is an example of a producer and consumer bacteria in a syntrophic relationshi…
5337 The cardinal signs of inflammation are...…
5343 The formation of extracellular polymers (glucans) in <em>S. mutans </em>and <em>S. sanguis </em>atta…
5344 Because it has porins, the outer membrane is a permeability barrier.…
5345 From a population perspective, what percent of life on Earth is microbial?…
5346 From a biomass perspective, what percent of life on Earth is microbial?…
5347 If you compare the <em>average size</em> of the following microbes, which is the <em>smallest</em>?…
5348 If you compare the <em>average size</em> of the following microbes, which is the <em>largest</em>?…
5349 Which of the following are positive impacts of microorganisms?…
5350 Negative impacts of microorganisms on human society include...…
5351 Bacteria cause harm to humans by killing or inhibiting the growth important crops…
5352 In industry, microorganisms contribute in many positive ways. For example (There are three correct a…
5353 The structure shown is a... <img alt="A sugar baby" src="https://instruction.bact.wisc.edu/images/q…
5354 Bacterial DNA is located within the nucleoid. This is organize by…
5355 A carboxysome is an enzyme complex that…
5356 Only living organisms can synthesize organic compounds such as amino acids.…
5357 Let's compare a yeast cell (a non-photosynthetic microorganism) to a bacterial cell like <em>E. coli…
5358 In comparing the cell membrane of <em>E. coli</em> (Bacteria) to <em>Methanothermobacter thermautotr…
5359 Order the steps of viral infection.…
5360 Here is a typical viral particle...</p> <img alt="A diagram of a virus" src="https://instruction.ba…
5361 Bacterial transcription is different from Archaea and Eukarya in that…
5362 A (+) ssRNA virus that infects a Eukaryotic cell would most likely replicate in&hellip;…
5363 In rho-dependent termination in bacteria, the rho protein……
5364 The actual process of translating from the language of nucleotides (codons) to protein is carried ou…
5365 If you are trying to classify a microorganism phylogenetically, what trait would be best to look at?…
5366 The last universal common ancestor (LUCA) probably generated energy by……
5367 Microorganisms can affect the food supply chain by...…
5368 If truck drivers get sick because of influenza, that can disrupt the food supply chain.…
5369 One way to prevent leaf rust (caused by <em>Puccinia triticina Eriks</em>) from inhibiting your whea…
5370 Leaf rust affects the food supply chain by...…
5371 Pick all the elements that are macronutrients…
5372 Pick all the elements that are macronutrients…
5373 Pick all the elements that are micronutrients…
5374 <em>Shighella dysenteriae</em> requires NAD to be able to grow. Therefore, NAD is a ________________…
5375 <em>Bacillus cereus</em> requires the element magnesium for growth. This makes Mg a growth factor fo…
5376 Here is the recipe of a medium:</p> <p>&nbsp;</p> <table border="1" cellpadding="1" cellspacin…
5377 Here is the recipe of a medium:</p> <table border="1" cellpadding="1" cellspacing="1"> <thead> …
5378 <img alt="The electron potential table" height="412" src="/images/quickcheck/electrontower.png" widt…
5379 Substrate phosphorylation (SLP) differs from electron-transport level phosphorylation (ETLP) in that…
5380 The latter steps in fermentation often involve the reduction of an organic substrate (i.e. The reduc…
5381 You add <em>Lactococcus lactis </em>(a homofermentative bacterium) as a starter culture to your milk…
5382 During chocolate fermentation, spore-forming bacteria dominate late in the process. This is because…
5383 The FtsZ protein is common in many types of cells. It is required for...…
5384 If a cell lost the activity of the FtsZ protein it would...…
5385 An advantage turbidity measurements have over viable plate counts are……
5386 A microorganisms that forms long tubes, called mycelia, increases by…
5387 A stalked bacterium that divides into two unequal cells use this mode of cell division.…
5388 Some of the advantages for bacteria living in a bioflim are……
5389 The disadvantages of living in a biofilm are&hellip;…
5390 Temperature kills bacteria because……
5391 Temperature kills bacteria because&hellip;…
5392 A bacterium grows in a high-temperature (70°C) hot spring at pH 3. You would classify this bacterium…
5393 If a bacterium doesn't have superoxide dismutate or catalase it is probably a…
5394 Bacteria can survive without carbon sources in the environment because they store carbon in……
5395 Sulfur-oxidizing bacteria if they run into excess hydrogen sulfide will store it as…
5396 When the bacterium <em>E. coli</em> begins to starve, it will change the expression of many genes by…
5397 When Giardia is released from a host into the environment, it will&hellip;…
5398 The most hardy form of resting structure is a……
5399 The cyanobacteria <i>Anabaena variabilis</i> can differentiate in three ways. Which differentiated c…
5400 The cyanobacteria <i>Anabaena variabilis</i> can differentiate in three ways. Which differentiated c…
5401 The majority of nitrogen fixation on Earth is done by Bacteria…
5402 The majority of nitrogen fixation on Earth is done by humans…
5403 Conversion of ammonia to nitrate involves (There are two correct answers)…
5404 A farmer spreads nitrogen fertilizer (nitrate) on his corn crop and expects it to increase his yield…
5405 Loss of food to spoilage by microorganisms is a significant problem in our food supply chain…
5406 Sterilization is the……
5407 Disinfetion is&hellip;…
5408 What physical treatment would you use to sterilize a liquid that contains bacteria as well as small …
5409 You want to preserve some meat for the winter in your cabin. However, the power supply to the cabin …
5410 The main goal of wastewater treatment is to……
5411 The main difference between water treatment to produce drinking water and wastewater treatment befor…
5412 In β-oxidation……
5413 In the degradation of n-octane from oil, octane is converted into a fatty acid and then Conenzyme-A …
5414 The energy of high-potential electrons is converted into charge separation across the membrane by th…
5415 An <em>E. coli</em> strain has a mutation in the <em>lacZ</em> gene such that it cannot produce its …
5416 The <em>lac</em> operon encodes a repressor. The repressor is inactivated by its signal molecule all…
5417 In <em>E. coli </em>the <em>lac</em> operon is regulated by…(There are two correct answers)…
5418 MalT controls maltose operon gene expression. This protein is...…
5419 If AgrB of the quorum sensing system of <em>Staphylococcus aureus</em> was inactivated, what part of…
5420 What would happen to <em>E. coli</em> cells growing under normal conditions (i.e., no DNA damage) if…
5421 You are trying to understand a biofilm that forms on your patients' catheters. You need to know what…
5422 Amplicon sequencing is different than metagenomics in that.…
5423 Your, old, old, old school professor, is interested in learning the microbiome of moldy bread. He ch…
5424 You are investigating  landfill that has been contaminated with oil. Before you start investigating …
5425 The fungus Phanerochaete chrysosporium degrades lignin. If you were putting it in a community physio…
5426 Cellulose is degraded by&hellip;…
5427 Some <em>Syntrophomonas</em> sp. oxidize butyrate into acetate and hydrogen. This reaction is only f…
5428 The bacterium ac1-B1 is one of te most common phylotypes in lakes. In the oceans, <em>Pelagibacter u…
5429 Besides sodium chloride, oceans differ chemically from fresh water in that oceans have...…
5430 The most common microbial genera found in the oceans is……
5431 <em>Pelagibacter ubique</em> was difficult to isolate because it&hellip;…
5432 <em>Prochlorococcus</em> sp and <em>Synechococcus</em> sp. are found throughout the ocean's surface …
5433 Methanogens that grow on hydrogen gas and carbon dioxide are present at deep-sea ocean vents.…
5434 What are the properties of <em>Geoglobus ahangari</em>, a deep-sea ocean vent bacterium? (There are …
5435 Because of the lack of dissolved organic carbon chemoheterotophic bacteria are <strong>not</strong> …
5436 The most important role of carotenoids in photosynthesis is……
5437 The purpose of light-harvesting complexes in photosynthesis is to&hellip;…
5438 If you removed the magnesium ion from the special pair of bacteriochlorophyll, it would no longer be…
5439 Chlorosomes differ from phycobilisomes (the light-harvesting complexes of cyanobacteria) in that chl…
5440 Purple bacteria are unusual for photosynthetics because they have several modes of growth. They can …
5441 Methylotrophs are autotrophs that generate organic carbon using the……
5442 One of the major differences between aerobic vs anaerobic methane oxidation is&hellip;…
5443 Fermenting organisms need a lot of organic compounds because they get less energy from each substrat…
5444 If you had a mutation in adenylate cyclase such that it no longer could make cAMP, this mutant <em>E…
5445 The RNA III product used in quorum sensing in <em>Staphylococcus aureus </em>is an example of……
5446 Given the physiology of the ocean, where will you find photosynthetic bacteria?…
5447 The majority of carbon dioxide put into the atmosphere comes from humans sources.…
5448 Deep-sea ocean vents are teaming with life because……
5449 The skin is an effective antimicrobial barrier for many microorganisms because&hellip;…
5450 <div class="question_text user_content enhanced" id="question_new_question_text"> One example of ho…
5451 Two examples of antimicrobial secretions your immune system creates are&hellip;…
5452 If a person had a gene mutation that prevented them from making the cytokine interleukin 12, it woul…
5453 Complement can be activated in three ways. They are&hellip;…
5454 One way that the complement system kills microorganisms when activated is by&hellip;…
5455 One symptom of inflammation is redness. This is caused by&hellip;…
5456 The major phagocytic cells in the body are (there are three correct answers.)…
5457 Activation of the complement cascade will result in the migration of phagocytes to an area.…
5458 C3b and IgG are both opsonins. In this capacity, they&hellip;…
5459 Phagocytes can kill in several ways. Which of the following is an oxygen-independent method?…
5460 Pattern Recognition Receptors (PRR) react to _________ and alert the immune system.…
5461 An example of a MAMP that the immune system would respond to is&hellip;…
5462 The human immune system can respond to millions of antigens, yet the genome consists of only 30,000 …
5463 Dendritic cells are a special class of neutrophils that can kill bacteria, but are also antigen-pres…
5464 When activated, a B-cell will differentiate into&hellip; (There are two correct answers)…
5465 One way antibodies cause harm to pathogens by&hellip;…
5466 A&nbsp;cytotoxic T-cell. (Tc) will sense a host cell is infected by a virus when&hellip; (Note: anot…
5467 CD4+ T-cells (T-helper cells) function to&hellip;…
5468 If plants did not form mutualistic relationships with mycorrhizal fungi, they would have a harder ti…
5469 Rhizobia are attracted to plants because&hellip;…
5470 Consider they ratio of phylotypes found in the skin microbiota. If you compare people&#39;s skin mic…
5471 <em>Staphylococcus epidermidis </em>is found on the skin of 100% of people. This bacterium has many …
5472 The biggest impact disruption of sleep has on the microbiome is&hellip;…
5473 One of the best pieces of evidence that the microbiome can influence depression and anxiety is&helli…
5474 We say so corporation has developed a new probiotic that contains <em>Eubacterium</em> and <em>Copro…
5475 Your uncle, who is at risk for heart disease, doesn&#39;t want to eat more fiber. He says eating mor…
5476 Match the causative agent with the virulence factor/properties…
5477 An insect vector transmits these two disease agents.…
5478 Earlier in the year, we talked about Prion diseases. These diseases can satisfy Koch&#39;s postulate…
5479 The shiga toxin produced by <em>Escherichia coli</em>, is a&hellip;…
5480 You are investigating a new operon that synthesizes ladderines. You find that the final product bind…
5481 You suspect that carbenicillin resistance can move from&nbsp;<em>Bucky borderii, </em>a harmless bac…
5482 <em>Akkermansia muciniphila</em> is an inhabitant of the gastrointestinal tract and has an important…
5483 The microbiota on&nbsp;teeth that form plaque may play a role in causing.…
5484 Water coming from a surface source is not safe due to contaminants. The water is first passed throug…
5486 A patient is treated with an antibiotic with a mechanism of action that involves inhibiting transpep…
5487 All of the following are steps and&nbsp;appropriate&nbsp;descriptions of the Virus life cycle EXCEPT…
5490 Why is DNA used as the primary hereditary material instead of RNA?…
5491 After replictaion a section of DNA ends up with a mutation. However, after translation, the mutated …
5492 A scientist studies two RNA viruses. Virus A can be translated by host ribosomes immediately after i…
5494 What is the defining feature of a <strong data-end="601" data-start="578">lysogenic infection</stron…
5495 Which statement accurately describes the relationship between the lytic and lysogenic cycles?</p> …
5496 A newly discovered microorganism is found to have membrane lipids composed of isoprenoid side chains…
5497 In what way does most water&nbsp;enter&nbsp;bacterial cells?&nbsp;…
5498 You stain a bacterial cell and observe under a light microscope a clear thick border around the edge…
5500 The three main components of LPS in Gram-negative cells are…
5502 A key difference in the regulation of lytic versus lysogenic pathways between bacteriophage T4 and l…
5503 RNA is always single stranded and DNA is double stranded. True or false?…
5507 An antibiotic specifically targets lipopolysaccharide (LPS). Which group of bacteria would be most d…
5508 Which of the following correctly describes a structural difference between DNA and RNA?…
5509 A scientist discovers two bacterial isolates have&nbsp;16S rRNA sequences that are 99% similar, but …
5510 Two populations&nbsp;of the same bacterial host are infected&nbsp; with bacteriophage&nbsp;λ under d…
5511 Bacteriophage λ must decide between lytic growth and lysogeny shortly after it infects <em>E. coli</…
5512 Which property is correctly associated with the indicated transport mechanism?</p> <p>&nbsp;</p> …
5516 Flagella and pili both can exhibit multiple conformations they can exist in, which of the following …
5517 What is an advantage of sequencing 16S rRNA that makes it useful in classifying organisms?&nbsp;…
5518 A bacterium&nbsp;is grown in a medium containing high concentrations of glucose. When the glucose is…
5520 Correctly match the person to what they are most known for…
5521 While watching SpongeBob SquarePants,&nbsp;a microbiology student jokes that Bikini Bottom must be f…
5522 A microbiologist compares 16S rRNA gene sequences from several microorganisms to determine their rel…
5523 Modern classification is based on phylogenetic relationships. Which of the following correctly lists…
5524 What is a unique characteristic of group transporters when compared to&nbsp;other transporters (pass…
5527 What main feature of eukaryotes differentiates them from prokaryotes?…
5528 A researcher isolates a microorganism from a deep-sea hydrothermal vent. The organism lacks a nucleu…
5533 A major contribution from Edward Jenner was…
5535 A researcher is studying human cell DNA and wants to test how mutations affect cell division. Which …
5536 A cell membrane transports glucose into a bacterial cell while simultaneously transporting an Na<sup…
5537 Which of the following is a function of inclusions?…
5539 Which of the following is a fundamental similarity between Eukaryotes and Prokaryotes in translation…
5540 What problem lead Louis Pasteur to the discovery of Germ Theory?…
5541 During receptor mediated endocytosis, what specialized membrane region do the receptors migrate to b…
5543 Which statement&nbsp;best&nbsp;distinguishes Eukarya from&nbsp;Bacteria and Archaea?…
5544 Which of the following best explains why 16S rRNA is widely used to construct phylogenic trees?…
5545 Which of the following are features shared in&nbsp;all three domains of life?…
5546 When developing the Germ theory, Louis Pasteur studied which of the following…
5547 During the development of solid culture techniques, a microbiologist observed that the medium liquef…
5551 A major difference between a bacterial capsule and the slime layer is…
5552 Which are&nbsp;evidence for endosymbiotic theory across all domains?…
5553 You are a virus trying to invade a host cell. Your genetic information is single-stranded, and it ha…
5554 Which molecule targets peptidoglycan at the peptide cross-bridges between N-acetyl muramic acids?…
5558 The DNA double helix forms when two antiparallel strands of nucleotides associate. Which mechanism c…
5559 A microbiologist wants to determine the evolutionary relationship between two newly discovered micro…
5560 A student is examining an unknown microorganism and observes that it lacks a membrane-bound nucleus …
5563 What was a major contribution&nbsp;Angelina and Walter Hesse made to the field of microbiology?…
5564 A key difference between DNA and RNA is that DNA contains thymine while RNA contains uracil. Why doe…
5565 What feature of Archaea help them survive&nbsp;in extreme environments?…
5566 <meta charset="UTF-8" /> <span style="font-family:Times New Roman,Times,serif;">Which transport mec…
5567 A key difference in the structure between Gram-positive and Gram-negative cells is that gram negativ…
5568 A researcher isolates a virus that has a negative single-stranded RNA genome. After entry into a hos…
5570 What is the function of flagella as a component of the cell&#39;s structure?&nbsp;…
5571 Which option below correctly describes how Lysozyme and Penicillin affect a bacterial cell wall?…
5572 A cell membrane is analyzed and found to contain amphipathic lipids with isoprenoid side chains atta…
5573 During protein synthesis, molecular chaperones assist in the process by…
5574 A bacterium is shifted from 37&deg;C to 10&deg;C. Which change in membrane composition would best ma…
5576 Which characteristic best&nbsp;differentiates archaea&nbsp;cell walls from bacterial cell walls?…
5579 Fresh orange juice needs to have its shelf life extended without completely sterilizing it or signif…
5580 The F1 subunit of ATP synthase consists of 3 alpha and 3 beta proteins. How is the F1 subunit powere…
5581 How does the chemistry of electron carriers as well as their spatial arrangement, specifically in th…
5582 A researcher observes bacterial cells attaching to a surface and later forming structured communitie…
5583 A bacterium is growing in an environment where oxygen is absent but electron donors and acceptors ar…
5585 You find a microbe living in extreme environment conditions, thriving at temperatures of 90 &deg;C. …
5586 You just discovered a new species that is able to live in the presence in oxygen. Upon further analy…
5587 A microorganism uses retinal to absorb light and pump protons across its membrane. It makes ATP but …
5590 Which of the following correctly compares retinal-based phototrophy and cyanobacterial photosynthesi…
5592 Before administering a shot at the doctor's office, what method might the nurse use to ensure the ar…
5593 An individual is looking to clean off their dishware by reducing the pathogens down to save level so…
5595 In which environment would you most expect to find psychrophiles and why?&nbsp;…
5596 What is the role of superoxide dismutase in aerobes?…
5598 What does it mean to remove all pathogens from an inanimate surface but not eliminate all microbes?…
5601 During kimchi fermentation, you observe <strong>gas production early</strong>, then later gas produc…
5602 <em>Lactococcus lactis</em> can&#39;t grow without adenine present this means:…
5603 How is Retinal-Based Phototrophy different from&nbsp;photosynthesis in purple bacteria? Select all t…
5604 A facultative anaerobe is exposed to oxygen. Which enzymes are going to become more active after thi…
5608 A major difference between the electron transport chain of green sulfur bacteria and cyanobacteria i…
5609 A scientist grows two cultures and observes the end products. Culture one produced lactate, CO<sub>2…
5611 A cell&rsquo;s ATP production increases in aerobic environments. Which shared feature of β‑oxidation…
5612 Which pigment in Cyanobacteria and plants becomes excited and donates an electron to the electron tr…
5614 A scientist wants to test which medium a bacteria grows the fastest in at 30&ordm; C. During the exp…
5618 How would someone extend the shelf life of a fresh apple pie?…
5619 What differentiates the light harvesting complex of green&nbsp;bacteria compared to cyanobacteria an…
5620 Which statement best describes the relationship between metabolism, catabolism, and anabolism?…
5625 A newly discovered organism was found in certain glacial water pools (Temps ~5C) near small salt dep…
5626 Which of the following best describes a key difference in the photosynthetic systems of cyanobacteri…
5627 What kind of organisms can tolerate the presence of oxygen but does not use it?…
5635 A new species of microbe was found deep in an Amazonian cavern. When brought to a local laboratory, …
5636 A microbiologist isolates a bacterium from lake sediment and grows it in a laboratory batch culture …
5638 During the biochemical process of beer fermentation, a metabolic intermediate can influence the flav…
5639 Select all the ways cyanobacteria adapt to lower nitrogen availability.…
5640 <meta charset="UTF-8" /> A microorganism breaks down glucose without using an external electron tra…
5642 As a novice home brewer, you are excited to share your beer with your friends. However, a&nbsp;frien…
5643 What feature is shared by aerobic and anaerobic respiration?…
5644 A major difference between acidophiles and alkalophiles is that:</p> <p>&nbsp;</p> <p>&nbsp;…
5645 During microbial metabolism, many pathways involve the transfer of electrons between molecules. A sc…
5647 A mutation prevents rotation of the central shaft of ATP synthase, but the proton gradient across th…
5650 Which feature&nbsp;is&nbsp;shared by retinal-based phototrophy and the photosynthetic apparatus of p…
5653 In an anaerobic environment a bacterium metabolizes glucose via glycolysis but lacks an electron tra…
5654 After the brewing process was complete, the beer had a green apple taste to it. What problem occurre…
5655 A major difference between oxidative respiration and fermentation&nbsp;is that?…
5657 In <em>E. coli</em> where does the FtsZ assemble?…
5659 A microbial cell is carrying out the reaction:</p> <p data-end="771" data-start="758">A + B ⇌ C +…
5661 Some photosynthetic bacteria can grow in very low-light environments because they have specialized l…
5664 In horizontal gene transfer systems:…
5666 You have a strain that makes B12, and your vitamin company has tasked you with mutagenizing the stra…
5667 You want to sequence the bacterial genome of a new isolate, <em>Henkus jaminicus</em>. You suspect t…
5670 In <em>Staphylococcus aureus</em>, a mutation prevents AgrC from phosphorylating AgrA, but all other…
5671 Which method would allow you create a mutant version of Escherichia coli in a laboratory setting?&nb…
5672 How is&nbsp;<em>Ferroplasma acidarmanus</em> different from&nbsp;<em>Leptospirillum ferrooxidans</em…
5673 A researcher grows <em>E. coli</em> in minimal medium containing both glucose and lactose and observ…
5674 A microbiologist compares two methods to analyze a soil sample: (1) culturing microbes on standard l…
5675 Under what conditions would the cAMP molecule have the lowest concentration?…
5677 You have isolated a suspect pathogen,&nbsp;<em>Bucky baderous</em>. You want to determine if it has …
5678 You want to isolate a chitinase from&nbsp;<em>Streptomyces coelicolor.&nbsp;</em>You have the comple…
5679 Which of the following operons involves regulation by the means of attenuation?…
5680 What conditions might trigger an increase in the expression of heat shock genes, given that there is…
5681 <span style="font-size:12pt; font-variant:normal; white-space:pre-wrap"><span style="font-family:'Ti…
5682 A newly discovered organism has 2 protein system with Protein A and B. Protein A is long-lived and w…
5683 Which of the following is a major difference between cellulose degradation in aerobic vs anaerobic b…
5684 Which statement correctly compares aerobic and anaerobic methane oxidation?…
5685 Which statement best describes how cellulosomes enhancer cellulose degradation under anaerobic condi…
5686 Which of the following accurately describes characteristics of&nbsp;a selection or a screen?…
5687 Match the diversity technique with the function.…

Quickcheck 4.3.8 / Zikula 3.1.0 / Symfony 5.4.1 / PHP 8.1.2-1ubuntu2.23