| Question ID | Question Stem Text |
|---|---|
| 3 | You are trying to remove all bacteria from a solution by filtering it. What is the maximum pore size… |
| 4 | He was a Dutch merchant who as a hobby ground glass lenses and would examine various samples. He rep… |
| 5 | Of the following pairs, which ones are most closely related. You will need to consult a phylogenetic… |
| 6 | If you wanted to examine the structure of an intact flagellum on the surface of a bacterial cell in … |
| 7 | A major difference between previous, traditional classification systems and molecular phylogeny is t… |
| 8 | Dr. Lynn Margulis proposed that the mitochondria is actually an endosymbiont whose distant ancestor … |
| 10 | Microorganisms are important for our health because… |
| 11 | Studying microorganisms is worthwhile because… |
| 12 | Which general statement is true of “universal” cellular structures found in all three Do… |
| 13 | Though prokaryote is not an accurate phylogenetic grouping, Bacteria and Archaea do share certain st… |
| 14 | DNA is used in lieu of RNA as the hereditary material because… |
| 16 | Which of the follow transport mechanisms cannot concentrate molecules… |
| 17 | What are the wavy appendages coming out of the cell shown in the photomicrograph?<br /> <img alt="" … |
| 19 | <i>E. coli</i> makes an aquaporin, AqpZ. Deletion of this gene (removal of the activity from the cel… |
| 20 | To transport glucose across a membrane a bacterial cell would most often use… |
| 21 | The nucleoid is… |
| 22 | A bacterial strain has a mutation such that it can only synthesize saturated fatty acids. This mutan… |
| 24 | A major difference between Gram-negative and Gram-positive cell wall structure is that… |
| 25 | The shape of almost all rod-shaped cells is partially dictated by… |
| 26 | Efflux pumps and secretion systems both __________, but are different because secretion systems ____… |
| 27 | Which of the follow statements about the cell envelope is false… |
| 28 | Major cellular differences between Eukarya and Archaea include...… |
| 29 | Major cellular differences between Eukarya and Bacteria are… |
| 30 | An individual virus can have a genome composed of… |
| 31 | The outcome of viral infection can take several paths for bacteriophage and animal viruses. Of the o… |
| 32 | Animal viruses can enter cells in a manner that is unique to animal cells. This method is by… |
| 33 | If you compare the Qβ bacteriophage to λ bacteriophage, the major difference between them is… |
| 34 | A researcher has found a new primate virus that is devastating the chimpanzee population. As a first… |
| 35 | A microbe growing in a lake, using carbon dioxide as its carbon source, hydrogen sulfide as its sour… |
| 36 | You create a mutant strain of <i>Bacillus cereus</i> (a facultative anaerobe) such that it has an in… |
| 37 | In E. coli if you create a strain that no longer has the MinC protein. This strain would… |
| 38 | Which of the following classes of microorganisms have mycelial growth and form spores… |
| 39 | The insulin gene, including its promoter and terminator, is cloned from a human pancreas cell into <… |
| 40 | About 30% of base pair changes in genes on DNA have no effect on the amino acid translated. This is … |
| 41 | The actual translation of the genetic code from nucleic acid to amino acid takes place during… |
| 42 | When growing in the environment, microorganisms stick together via an extracellular, polysaccharide … |
| 44 | An excellent piece of evidence that chloroplasts in plant cells are ancient symbionts descended from… |
| 46 | You have isolated a new protozoan that has an unusual inclusion. You think the inclusion is actually… |
| 47 | The metabolic pathway for the synthesis of glycine is 90% similar between <i>E. coli</i> and the pla… |
| 48 | One approach to defining species in Bacterial and Archaeal strains is to count any two strains that … |
| 49 | Archaea and Bacteria share this trait...… |
| 50 | In your research, you are trying to determine the phylogenetic relationship between a group of 15 pr… |
| 51 | Of the following pairs, which ones are most distantly related. You will need to consult a phylogenet… |
| 52 | Bucky Badger has isolated a new microorganism off of the turf on the marching band field. His candid… |
| 53 | One of the major contributors to the foundations of molecular phylogeny and modern phylogenetic clas… |
| 54 | A major difference between Gram-negative and Gram-positive cell wall structure is that ...… |
| 58 | If an attractant was present, cells do which of the following?… |
| 59 | What is the function of the Pribnow box?… |
| 60 | Who discovered the vaccine for smallpox?… |
| 61 | What is a difference in archaeal cell membranes compared to eukaryotic membranes?… |
| 62 | DNA viruses most commonly replicate in the __________, while RNA viruses most commonly replicate in … |
| 63 | What do RNA viruses and DNA viruses that infect bacteria have in common?… |
| 64 | The common cold is caused by an RNA virus called rhinovirus. Why is it so hard to control the spread… |
| 65 | Which of these is false regarding ways in which microorganisms impact our lives?… |
| 66 | <table class="table table-striped"> <tbody> <tr> <td>Seq A</td> <td>C</td> <td>C</t… |
| 67 | Which statement best describes the relative size of microbes in relation to other organisms?… |
| 68 | Here is a set of alignments for 16S rRNA.</p> <p> </p> <table class="table table-striped"… |
| 69 | A molecule that contains a polar phosphate group along with two hydrocarbon chains is considered a _… |
| 70 | What happens to the transcription process in bacteria if the sigma subunit of the RNA polymerase was… |
| 71 | Which of the following is true for both Gram-positive and Gram-negative bacteria?… |
| 72 | Which of the following statements about the nucleoid is/are TRUE:… |
| 74 | The <i>fooA</i> gene has a single promoter. If this promoter was moved, so that it is downstream fro… |
| 79 | If you wanted to examine the morphology of a bacterium and determine its Gram stain reaction, you wo… |
| 80 | Pasteur was doing research for what institutions when he proposed the germ theory of disease?… |
| 81 | Which of the following is not a reason to study microbes… |
| 82 | What scientist first observed microorganisms and described them in detail using a microscope he made… |
| 83 | He created the compound microscope and observed fleas, molds, and plants among other things. He publ… |
| 84 | He and his laboratory created many of the microbiology techniques that we still use. These include s… |
| 85 | Variolation was a common practice in India and China. However, 1% of patients died from this treatme… |
| 86 | Solid growth medium is important in microbial research. Walter and Angelina Hesse developed the use … |
| 87 | The germ theory of disease states that… |
| 88 | A typical bacterial chromosome, if it were stretched end-to-end, would be about 1.5 mm in length. Th… |
| 89 | A major difference between previous, traditional classification systems and molecular phylogeny is t… |
| 90 | Dr. Lynn Margulis (and others) proposed that the mitochondrion is actually an endosymbiont whose dis… |
| 91 | Horizontal gene transfer (HGT) makes the concept of species in bacteria more difficult because… |
| 92 | If the environmental temperature rises a bacterium will stabilize the membrane by… |
| 93 | Bacterial sigma factors are important to… |
| 94 | Capsules and fimbriae share this function in common… |
| 95 | The cause of some infectious neurological illnesses such as Mad Cow Disease and Chronic Wasting Dise… |
| 96 | The figure shows the chemical structure of <img src="/images/quickcheck/LPS.png" />… |
| 97 | A rod-shaped cell has a mutation such that when the temperature is raised above 37°C, it can no long… |
| 98 | Many microorganisms, including E. coli exhibit chemotaxis. If you placed a tube filled with glucose … |
| 99 | Porins are only found in Gram-negative bacteria, their role is… |
| 100 | Major cellular differences between Eukarya and Archaea include… |
| 101 | Major cellular differences between Archaea and Bacteria are… |
| 102 | A difference between transport via group translocation and an ABC transporter is… |
| 103 | A new strain of penicillin-resistant <i>Staphylococcus aureus</i> has emerged. Your lab is frantical… |
| 104 | While there are many similarities in viruses that infect plants, animals, and bacteria, which of the… |
| 105 | Animal viruses can enter cells in a manner that is unique to animal cells. This method is by… |
| 106 | What is the lowest powered method that would allow you to see the structure of a protein?… |
| 107 | The insulin gene, including its promoter and terminator, is cloned from a human pancreas cell into <… |
| 108 | You create a pool of mutants such that each one changes one base pair in the coding region of in the… |
| 109 | Many Bacteria have either a Gram-negative or Gram-positive cell wall structure. However, there are g… |
| 110 | When a Flagella moves, it can move counterclockwise or clockwise. If it moves counterclockwise, what… |
| 111 | A cell in a warm environment, has a semi-permeable membrane that is ......in permeability than a cel… |
| 112 | Based on size what is the correct order of the following? (Smallest on the left to largest on the ri… |
| 114 | Which of the following best describes Archaea?… |
| 115 | The archaea cell membrane contains _______ lipids.… |
| 116 | Which is true in regard to microbes?… |
| 117 | Which of the following is a true statement regarding cellular transport processes?… |
| 120 | Suppose a hypothetical bacteria grows normal at 25 C and has a membrane lipid composition of 50% SFA… |
| 121 | You are working in a research lab this summer and your project is to isolate and characterize the en… |
| 123 | You cut two small wells into an agar plate and fill one well with a bacterial strain while filling t… |
| 124 | If Thonis Philipszoon had discovered microbes during the industrial revolution, would the cultivatio… |
| 125 | You are looking at a new strain of <i>Salmonella enterica</i> that was isolated from the latest outb… |
| 126 | A lipopolysaccharide layer can be found in some ________ walls.… |
| 127 | With which domain does archaea share the most molecular features?… |
| 128 | Both Gram-Negative and Gram-Positive cells have what structure in common?… |
| 129 | Which one of these is an important difference between animal viruses and bacteriophages?… |
| 130 | A major difference between facilitated diffusion and group translocation is...… |
| 131 | The proton gradient used to generate ATP is called the proton-motive force. How is it created in oxi… |
| 192 | What are iron-sulfur complexes used for?… |
| 193 | What are the end products of Emden-Meyerhoff-Parnas Pathway?… |
| 194 | Oh no! There is a severe drought in the forecast for an environment where a lot of photosynthetic ba… |
| 195 | Here are the two half-reactions. Predict flow of electrons and the electron potential drop</p> <t… |
| 196 | Due to a large amount of garbage dumped into the ocean, a large sulfide production zone appears. You… |
| 197 | How much free energy do you think is available at standard conditions to do work in the case of sulf… |
| 198 | A class of bacteria ferment butyrate to acetate and hydrogen gas. These microbes grow much faster in… |
| 199 | In general cells create energy by… |
| 200 | A major difference between substrate level phosphorylation (SLP) and oxidative phosphorylation (OP) … |
| 201 | ATP synthase works by…… |
| 202 | The wild fermentations of chocolate and Kim Chee involve successive fermentations by a number of dif… |
| 203 | In cheese making and yogurt production, homofermentative bacteria ferment sugars to… |
| 204 | You brew a batch of beer and want to make it high in alcohol content. The brewing seems to go fine, … |
| 205 | The <b>most important</b> role of carotenoids in photosynthesis is to… |
| 206 | In photosynthesis the light harvesting apparatus is used to… |
| 207 | What molecules in the reaction center actually ejects a high energy electron upon excitation by phot… |
| 208 | A new bacterium was discovered that grows on hydrogen gas and converts nitrate (NO3-) to nitrogen ga… |
| 209 | A new bacterium was discovered that grows on hydrogen gas and converts nitrate (NO<sub>3</sub><sup>-… |
| 210 | As part of respiration, protons are translocated across the membrane to create a proton gradient. On… |
| 211 | What physical method would you use to remove microorganisms from a solution of tetracycline? (Tetrac… |
| 212 | The unimaginable has happened and it's every man and woman for themselves in a zombie apocalypse. Yo… |
| 213 | Green bacteria contain a chlorosome. What structure in cyanobacteria serves the same purpose?… |
| 214 | <img alt="The fermentation pathway of bifidobacterium" src="https://instruction.bact.wisc.edu/images… |
| 215 | Which group of photosynthetic bacteria can grow as Photoheterotrophic organotrophs?… |
| 216 | What function do retinal-based phototrophy and purple bacteria photosynthesis share?… |
| 217 | A budding graduate student is preparing a medium to grow <i>E. coli</i>. To one liter of water he a… |
| 218 | A medium that contains a high concentration of nutrients where the exact amounts of are not complete… |
| 219 | Use the data shown below. Calculate the growth rate (k) for Medium 1 and Medium 2</p> <table clas… |
| 220 | You have a microbe that does not divide by binary fission, but instead forms long filaments. How cou… |
| 221 | Most microbes that live in the environment… |
| 222 | A microbe that can grow at a pH of 10 and a sodium bicarbonate concentration of 2 M would be conside… |
| 223 | Cells are killed at high temperatures because… |
| 224 | Halophiles and halotolerant bacteria protect themselves from high solute concentrations by… |
| 225 | Aerobes can survive in the presence of oxygen because… |
| 226 | When nutrients become unavailable microorganisms can react by in a number of ways. Which of the foll… |
| 227 | Of the following resting structures, which do you think are most resistant to heat?… |
| 228 | The cyanobacterium <i>Anabaena variabilis</i> forms long filaments during growth, under nitrogen lim… |
| 229 | The zombie apocalypse continues. You and your band have destroyed the zombies in your area, but one … |
| 230 | Which of the following statements about endospores are correct?… |
| 231 | <i>Methylococcus capsulatus</i> uses methane as energy source and reducing agent to yield energy by … |
| 232 | What is the most likely order of electron flow for oxidative phosphorylation? Hint, use the electron… |
| 233 | Which sequence below shows the correct order for the synthesis of ATP through the generation of the … |
| 234 | What is a major difference between the role of chlorophyll and carotenoids in a reaction center?… |
| 236 | How does ATP synthase use the proton motive force?… |
| 237 | When <i>Bacillus</i> species experience nutrient deprivation, they...… |
| 238 | Out of the following multi-step reaction listed below, what is the best way to describe the reaction… |
| 241 | Which of the following best describes the relationship between trace elements and growth factors… |
| 242 | Which of the following correctly describes the role of chlorophyll and/or carotenoids in a reaction … |
| 243 | Which of the following best describes how protons move across the cell membrane… |
| 245 | The most abundant elements found in all microbes as a percentage of dry weight are, on average:… |
| 246 | During __________ a free phosphate group is joined to ADP by ATP synthase using the energy from the … |
| 247 | Which is true of the differences and similarities between green bacteria, purple bacteria, and cyano… |
| 248 | Which of the following about retinal-based phototrophy is false?… |
| 249 | Which of the following is a true statement regarding retinal-based phototrophy and classic photosynt… |
| 250 | What is false regarding the photosynthetic apparatus (Reaction Center, Electron Transport Chain and … |
| 252 | Which of the following is false about photosynthesis in green and purple bacteria?… |
| 253 | Which of the following statements is TRUE regarding respiration and fermentation:… |
| 254 | The Archaea <i>Halobacterium salinarum</i> is found in salted fish and hypersaline lakes, high salt … |
| 255 | Oxygenic and anoxygenic photosynthesis have many common traits, which of the following is NOT a comm… |
| 256 | If you are designing an experiment aimed at isolating and growing with a chemoautolithotroph, whic… |
| 257 | E.coli deal with starvation through hibernation, which involves the increase in expression of RpoS (… |
| 259 | For your microbiology lab exercise you need to isolate a bacterium from nature, so you decide to col… |
| 261 | Which method of ATP production is based on the action of an energy gradient?… |
| 262 | Purple bacteria, green bacteria, and cyanobacteria contain many similar light-harvesting centers. Ho… |
| 263 | If an organism is able to switch between aerobic and anaerobic respiration but they are in high dema… |
| 264 | According to the reduction potential table, which of the following sets of molecules are all capable… |
| 265 | Which of the following is not part of the process in which the FtsZ finds the middle?… |
| 266 | What environmental stresses do microbes respond to?… |
| 267 | In contrast to respiration, fermentation uses __ to generate energy and does not use __ in the proce… |
| 269 | Which of the following best describes the metabolism of methane? CH<sub>4</sub>+2O<sub>2</sub>-----… |
| 271 | Which of the following steps in the Emden-Meyerhoff (glycolysis) pathway involves an oxidation-reduc… |
| 272 | Which of the following is/are made using wild fermentative processes?… |
| 273 | If a cell wanted to increase its rate of forward reaction how could it accomplish this?… |
| 275 | A microbe degrades toluene and produces NADH, pyruvate, and acetyl-CoA. Which of the following pathw… |
| 277 | A new drug is known to destroy the H<sup>+</sup> gradient that forms in the electron transport chain… |
| 278 | Which of the following metabolic processes has the highest ATP yield?… |
| 279 | Why is oxygen necessary in aerobic cellular respiration?… |
| 281 | Which of the following statements about the electron transport chain is correct?… |
| 282 | A cell culture of an aerobic bacterium that is respiring glucose was supplied with radioactively lab… |
| 286 | Which of the following metabolic pathways uses sunlight to produce ATP and NADH?… |
| 287 | Which anoxygenic bacteria reaction centers are most similar to photosystem 1 and 2 in cyanobacteria?… |
| 288 | Choose the correct order of electron transport chain elements as well as how these elements generate… |
| 289 | Your research partner decides she wants to isolate a culture of Gram-negative bacterium that undergo… |
| 290 | In the reaction CH4+ 2O2---> CO2+ Energy+ 2H20 What happens to methane and why?… |
| 291 | In the Gibbs Free Energy Equation, δG= δH - TδS, increasing entropy (S) would resu… |
| 292 | If you reduce the concentration of products in a reaction, what happens to the rate of reaction and … |
| 293 | Which of the following is NOT a common way microbes utilize Hydrogen?… |
| 294 | Which of the following is true about the mechanisms of the electron transport chain during cellular … |
| 296 | A major difference between aerobic respiration and anaerobic respiration is...… |
| 297 | A group of researchers recently isolated a bacterium that they believe has never been studied before… |
| 298 | What is the correct order of fermentation progression of Kim Chee?… |
| 299 | Anoxygenic photosynthetic organisms use carotenoids for all of the following except..… |
| 300 | Which of the following are anoxygenic?… |
| 301 | Calculate the generation time of a bacteria at time 3 hours (CFU/ml = 2.00E+07) and time 7 hours (C… |
| 302 | Calculate the generation time of a bacteria at time 2 (CFU/ml = 2.00E+06) and time 9 (CFU/ml = 2.43E… |
| 303 | You are experiencing a microbial contamination problem in a cheese product you are developing. Whic… |
| 304 | NAD is an organic compound that is needed by <em>Leuconostonc mesenteroides</em> in small amounts bu… |
| 305 | NAD is an organic compound that is need by humans in small amounts, but can not be made on its own a… |
| 306 | What domain(s) are capable of methanogenesis?… |
| 308 | When predicting the relative rate of a forward reaction, it is known that increasing the amount of s… |
| 311 | Which of the following statements accurately describes the relationship between photosynthesis and o… |
| 312 | Making Kim Chee involves the fermentation of cabbage by lactic acid bacteria and coliforms. Which of… |
| 315 | Photolithoautotrophs differ from chemoheteroorganotrophs because they get their energy from ___, the… |
| 316 | ATP synthase can rotate the F<sub>0</sub> subunit and make ATP by the F<sub>1</sub> subunit under wh… |
| 317 | Which of the following about ATP synthase is false...… |
| 319 | What following points are true for a favored redox reaction?… |
| 321 | You start with a culture of 2.0E+6 E. coli cells at 7:00AM. Before you leave at 5:00PM you count 6.2… |
| 323 | Photosynthesis and retinal-based phototrophy both use light to create energy for organism. How are t… |
| 324 | The reaction 2NAD(P)H + 2H + O<sub>2</sub> --> NAD(P) + H<sub>2</sub>0 occurs commonly microbes. If … |
| 326 | Which of the following processes involve substrate level phosphorylation? The generation of ...… |
| 327 | A difference between endospores and cysts is?… |
| 328 | How does retinal-based phototrophy make energy from light?… |
| 329 | You have a <i>Bacillus</i> strain that assimilates nitrate to obtain the essential element. If a mut… |
| 331 | Why are purple bacteria great model systems for studying photosynthesis?… |
| 332 | You want to determine whether <I>Alicyclobacillus</i> is more heat resistant than <i>E. coli</i>. To… |
| 334 | The most resilient of the resting structures is _______ because_________.… |
| 335 | The electron transport chain uses redox reactions to pump protons across the cell membrane to create… |
| 336 | Why does a bacterium that is fermenting an organic substrate need to get rid of the excess NADH afte… |
| 343 | Which one of these is an important difference between planktonic cells and those living in a biofilm… |
| 344 | The electron transport chain in Gram-negative cells is located predominantly in the:… |
| 345 | <img src="https://upload.wikimedia.org/wikipedia/commons/b/bb/MaraisSalant.JPG" alt="a sea salt pond… |
| 346 | When evaluating growth, one disadvantage of measuring turbidity is that...… |
| 347 | Which of the following are end product(s) to glycolysis?… |
| 349 | Which of the following states the main difference between the Embden-Meyerhoff and Entner-Douderoff … |
| 350 | An alkalophilic bacterium is put into an environment with a low temperature and a high pH level (gre… |
| 351 | Which of the following is NOT a benefit of beta-oxidation?… |
| 353 | Which of the following responses are not associated with a hibernation approach to nutrient deprivat… |
| 355 | How do chlorophyll and carotenoids interact within the cell?… |
| 357 | In ethanol fermentation, acetaldehyde is converted into ethanol producing NAD+. In this reaction, th… |
| 358 | Which of the following is false regarding anaerobic and aerobic respiration?… |
| 359 | Which of the following classified organisms would you NOT expect to find in a mammalian GI tract?… |
| 360 | A culture is started in two growth media. Media 1 starts at 1.0E8 and ends after 10 hours at 8.0E9, … |
| 361 | NADH redox reduction potentials have a value of -340, while oxygen redox reduction potentials have a… |
| 362 | During starvation, microbial cells can undergo several changes while shifting into a hibernation mod… |
| 365 | Which of the following ingredients is could not be used in defined culture medium?… |
| 366 | Green bacteria and Cyanobacteria do NOT have what structure in common?… |
| 367 | What do Purple and Green bacteria NOT share?… |
| 368 | Light-harvesting complexes are located adjacent to the reaction centers in purple, green and cyanoba… |
| 369 | Which of the following is true about oxygenic photophosphorylation?… |
| 370 | All of the following are redox reactions except for:… |
| 372 | With these two half reactions, predict which way the reaction goes and the energy yield.<br /> SO4 … |
| 374 | Compared to regular photosynthesis light reactions, retinal-based phototrophy is dependent on which … |
| 375 | For the given reaction, A + B -> C + D: If the concentrations of A and C were doubled, How would the… |
| 376 | Each of these are a product of fermentation except:… |
| 378 | How are macronutrients and trace elements similar?… |
| 380 | What role do trace elements have in cell nutrition… |
| 382 | A microorganism goes into a starvation phase because it detects a lack of nutrients or some environm… |
| 383 | Lactic Acid is a major product in fermentation to create all these products EXCEPT which of the foll… |
| 384 | In a suspended liquid, you will most likely find__growing:… |
| 385 | How do lithotrophs and organotrophs differ?… |
| 388 | Which of the factors below could limit any type of bacterial culture growth in an environment...… |
| 389 | What type of metabolism is only capable of generating ATP by substrate-level phosphorylation.… |
| 390 | In order for an organism to absorb light, all of the structures below are necessary except for?… |
| 391 | Aerobic respiration and anaerobic respiration are alike due to which of the following:… |
| 392 | Your friend has taken up beer brewing as a hobby and insists you try their latest creation. Hesitant… |
| 393 | Two cultures were started in medium 1 and medium 2 at CFU/mL = 9.0E+06. At time 3, the CFU/mL for ba… |
| 395 | __________ in the electron transport chain get their electrons from NH Fe proteins and are reduced b… |
| 397 | Which of the following enzymes/processes can pump protons across a membrane… |
| 398 | Green bacteria and green-sulfur bacteria unlike purple bacteria and the cyanobacteria can photosynth… |
| 400 | Johnny Beer Belly was brewing beer but had to rush. His first batch tasted sweet and like cooked cor… |
| 401 | You are a young, hip and clever first year graduate student in a microbiology lab. Your PI has asked… |
| 402 | In which of these environments would bacteria never be found… |
| 403 | in a fermenting organism, how is ATP generated?… |
| 405 | A microbiologist wants to see what kinds of microbial life she can develop from things lying around … |
| 406 | A medium that supports the growth of many bacteria, but causes some to turn black if they utilize su… |
| 408 | A microorganism is isolated from a bog. Sampling from bog water yields Fe<sup>2+</sup> ions and Fe(O… |
| 409 | Which of the following is false?… |
| 412 | A likely final electron acceptor for aerobic respiration would be _____ and for anaerobic respiratio… |
| 413 | Micronutrients are essential for cell life. Which of the follow is a micronutrient which is used as … |
| 414 | You want to isolate a mutant bacterial strain of <i>L. mesenteroides</i> that can produce its own gl… |
| 415 | A major difference between homofermentation and heterofermentation is...… |
| 416 | If a microbe gets energy from the sun, electrons from organic compounds and carbon from organic comp… |
| 417 | In Fe/Mn reactions, these atoms serve to be...… |
| 419 | Which of the following DNA repair mechanisms generally has the lowest fidelity? What is the most com… |
| 420 | If a gene with the letters AAA (coding for Lysine) undergoes a point mutation to TAA (coding for a S… |
| 424 | You are given a sequence of DNA, but there is a mutation. Instead of one of the codons in the coding… |
| 425 | In microbial diversity, most primary producers in the ocean are _______ that obtain energy from ____… |
| 426 | A culture plate that only allows growth of a specific mutant microbe is an example of _________, and… |
| 427 | Were you to swim to the bottom of the marina trench and feed a tube worm a respiratory poison (oh th… |
| 430 | A researcher wanted to confirm the size of the gene sequence that they transformed into a bacteria's… |
| 431 | Because of the low pH, and presence of only minerals, chemoheterotrophic microorganisms are not foun… |
| 432 | In heat shock, the degradation of RpoH is an example of… |
| 433 | You are investigating a new operon that expresses proteins involved in arabinose catabolism. You fin… |
| 434 | In negative regulation, the regulating protein is called a… |
| 435 | MalT, in the presence of its signal molecule, binds to DNA and recruits RNA polymerase to the site. … |
| 436 | A strain carrying a frame-shift mutation in lacA would… |
| 437 | A strain is made carrying two mutations. One mutation is in <em>lacI</em> such that LacI behaves as … |
| 438 | A point mutation in the <em>trp</em> repressor (TrpR) is made so that it can no longer recognize its… |
| 439 | A point mutation in the trp repressor (TrpR) is made so that it can no long recognize its co-repress… |
| 440 | The three activities that are found in two-component systems are… |
| 441 | Proteins involved in the heat shock response fall into a number of categories. Which of the followin… |
| 442 | A point mutation is made in DnaK such that it can no longer bind to RpoH. This would likely… |
| 443 | Which of the following statements about quorum sensing are false.… |
| 444 | If the luxR gene of <i>Vibrio fischeri</i> is deleted. The strain would… |
| 445 | A point mutation is made in <em>agrD</em> such that the AIP no longer binds to AgrC. In this case, t… |
| 446 | A new bacterium has just been isolated. <em>Fredrica deermenii</em>. It's entire genome was sequence… |
| 447 | Which of the following are true for low copy number plasmids… |
| 448 | Which of the following is not true for DNA replication… |
| 449 | The mutation in the figure was probably caused by<br /> <img alt="A piece of DNA where T is mistake… |
| 450 | The system that would be used to repair a mutation in the DNA where two adjacent thymines have aberr… |
| 451 | You are interested in increasing the production of arginine (an amino acid) from a strain for its in… |
| 452 | Of the 3 methods of horizontal gene transfer we looked at, which one involves naked DNA in the envir… |
| 453 | You think that resistance to tetracycline is developing in the bacterial microbiota of cattle at a d… |
| 454 | If the untranslated region of an mRNA transcript that is controlled by a riboswitch is removed, it w… |
| 455 | Mutations in DNA can cause… |
| 457 | You are investigating the pollution of an environment with polychlorinated biphenyls (PCBs). You wan… |
| 458 | <i>Leptospirillum</i> sp. are found in the acid mine. Which of the following statements about the ba… |
| 459 | An amazing property of the respiratory chain of Acidithiobacillus ferroxidans , which uses Fe2+ as t… |
| 460 | A survey of the phylotypes of bacteria present in the soil shows that … |
| 461 | When comparing cellulose degradation aerobically vs. anaerobically… |
| 462 | Lignin degradation is different than cellulose degradation in that… |
| 463 | Which of the following is true… |
| 464 | <i>Peligabacter ubique</i> is… |
| 465 | Much of the photosynthesis that occurs in the oceans is done by… |
| 466 | When examining the deep sea ocean vent environment the kinds of life forms found are… |
| 467 | In the reductive acetyl-CoA pathway, the source of reducing power is ____________ and the final prod… |
| 468 | In comparing aerobic vs anaerobic methane oxidation, the major difference is that… |
| 469 | Which one of the following facts about the anammox reaction is false… |
| 470 | Which of the following statements about the nitrogen cycle is false… |
| 471 | Suppose you are looking for the phenotype of an <i>E. coli</i> strain that contains a transposable e… |
| 472 | Which of the following genes must be found on the chromosome of a bacterium?… |
| 473 | Given a DNA coding sequence of 5’ATG CTA TGC TTC TAG 3’, what type of mutations would occur if base … |
| 474 | Under what conditions would the lactose operon be turned on?… |
| 475 | An error in DNA replication replaces cytosine with thymine in the CGA codon. The resulting TGA codon… |
| 476 | Which of the following characteristics are shared by all deep sea microbes?… |
| 479 | Plants are to soil like _____ is to lakes, and they are both considered _________.… |
| 480 | A deletion mutation in trpB would… |
| 481 | One way plasmids ensure that they get passed on to daughter cells is by using a toxin-antitoxin syst… |
| 482 | A strand of DNA has the following mutation:</p> </p> <p><img src="https://instruction.bact.wisc.e… |
| 483 | A researcher has collected a sample of compost and wants to determine the number and identity of bac… |
| 484 | How does Aliivibrio fischeri, a bioluminescent bacterium, use quorum sensing to regulate the transcr… |
| 485 | You discover that your bacterial specimen has acquired a mutation in its DNA sequence and determine … |
| 486 | Which of the following is a similarity between transduction and transformation for pieces of DNA tha… |
| 487 | There has been an insertion of an incorrect base during replication in a DNA chromosome. Which of th… |
| 488 | A mutation in the<em> luxI</em> gene of <em>V. fischeri</em> has substantially decreased its activit… |
| 489 | If a cell has a nonsense mutation in the <i>trpR</i> gene, will there be higher, lower, or equivalen… |
| 491 | You are investigating a new operon that synthesizes ladderines. You find that the final product bind… |
| 494 | A mutation in the maltose activator protein occurred so that it could not bind to the maltose operon… |
| 496 | You over-hear your lab partner telling his parents that bacteriorhodopsin is a type of photosynthesi… |
| 499 | What will most likely happen to the squid if you have a nonsense mutation in the middle of <i>luxR<… |
| 500 | Which one of these is NOT a method that microorganisms use to control gene expression:… |
| 501 | You sequence the entire genome of an unknown microbe and discover multiple genes that are 80% conser… |
| 503 | What method of DNA repair will be used to fix a deleted base pair mutation?… |
| 504 | When a mutation in DNA causes both strands to be damaged in the same region and DNA polymerase to st… |
| 506 | Rhodopsins maintain energy balance in lake and ocean environments by:… |
| 507 | You are going to Mexico for spring break and want to be tan before you get there, so you decide to s… |
| 508 | Which of the following is a difference between a chromosome and a plasmid?… |
| 509 | If a mutant has a frameshift mutation in <i>malT</i> from the maltose operon, which of the following… |
| 510 | In which situation(s) is quorum sensing most advantageous for operon expression in a bacterial popul… |
| 513 | A crucial microbe in the low-light, deep sea regions of the ocean may include… |
| 514 | Generating free radicals is important to lignin degradation because:… |
| 516 | Which of the following is false about attenuation?… |
| 517 | A plasmid encodes a toxin-antitoxin system. After replication of a plasmid, the segregation process … |
| 519 | Nitrogen fixation converts nitrogen gas to ammonia. Some of this escapes into the environment. Howev… |
| 520 | Which microorganism will you NOT find in an acid mine?… |
| 521 | Which of the following is false regarding Nitrospira?… |
| 522 | A single base-pair mistake in DNA replication caused a stop codon to be present in the middle of a D… |
| 524 | Acetyl-CoA is an allosteric activator of Pyruvate Carboxylase. How would enzyme activity be affecte… |
| 525 | The trp repressor is inactive and cannot bind to the operator when… |
| 527 | A <i>Staphylococcus aureus</i> cell transfers DNA to a neighboring <em>Staphylococcus aureus</em> ce… |
| 528 | While sequencing a DNA strand from a nature isolate, you accidentally contaminate the sample with tr… |
| 530 | In an experimental setting mice are injected with a heat killed, lethal, capsule-containing variatio… |
| 531 | A pyrimidine dimer mutation is formed. This was most likely caused by ______ and will most likely be… |
| 532 | Why do fungi use a lignin peroxidase to break apart lignin instead of a lignin enzyme?… |
| 533 | Before mutation, a DNA sequence codes for the protein arginine when translated and transcribed. Afte… |
| 534 | If a DNA coding sequence of a gene was mutated so that instead of reading 5' TAAGTAAACCCG 3' it read… |
| 535 | A deletion mutation in trpD would… |
| 536 | Which of the below processes involve a riboswitch regulating gene expression?… |
| 537 | Plasmids and chromosomes both encode for DNA in bacteria, non-essential and essential respectively. … |
| 538 | Plasmids are "selfish DNA". What about them makes them virus-like?… |
| 539 | If a strain is growing on a Rich medium lacking both glucose and lactose, what would CRP (also known… |
| 540 | A deletion mutation inactivates <em>lacZ</em> of the <em>lac</em> operon. What would happen to the c… |
| 541 | What is the primary function of the TrpR regulatory protein?… |
| 543 | Would the elimination of microbial rhodopsins from lakes be beneficial or detrimental to large lake … |
| 544 | Horizontal gene transfer occurs in several different ways. What are those ways?… |
| 546 | Operons that exhibit catabolite repression are under control of the catabolic activator protein (CAP… |
| 547 | In an oligotrophic lake how do <i>Anabaena</i> species get their energy?… |
| 548 | In catabolite repression, RNA polymerase is recruited by cAMP:CAP to various promoters when the aden… |
| 549 | A mutation in the <i>trp</i> operon causes TrpR to be synthesized in a high concentration of tryptop… |
| 551 | You have a system where a small metabolite thiamine pyrophosphate (TPP) binds to the mRNA that encod… |
| 552 | Which form of repair would be used to reverse TT dimers?… |
| 555 | Which of the following is NOT a category of heat shock proteins?… |
| 556 | If the antisense RNA SymR in <i>E. coli</i> was mutated and could no longer bind to its complementar… |
| 557 | Which of the following is not a characteristic of Bacteriorhodopsin?… |
| 558 | If the temperature increases in an environment what would happen to RpoH in the heat-shock response?… |
| 559 | At low temperatures, the mRNA translation of RpoH...… |
| 561 | You are examining a newly isolated bacterium and observe some variation within the population. Some … |
| 563 | Dr. Brown, a pathologist, wants to detect a specific bacterial pathogen they suscpect is present in … |
| 565 | A loop is formed on mRNA that includes the Shine Delgarno sequence. The increase of a metabolite cau… |
| 566 | What might cause a T-T base pairing and how might this mutation be fixed?… |
| 568 | DNA can experience errors, and damage. Nucleotide excision repair is a system that can repair DNA. … |
| 569 | What benefit(s) do bacterial cells gain from quorum sensing?… |
| 570 | What kind of repair is used when an area of DNA is damaged, and the corresponding strand is also dam… |
| 571 | What difference in cellulose and lignin structure causes one to use a unique peroxidase that generat… |
| 573 | What system are newly developed antibiotics targeting?… |
| 575 | What provides the additional energy needed by <i>Peligabacter</i> SARI I for all the biomass in the … |
| 576 | How does the regulation of a catabolic operon differ from how an anabolic operon is regulated?… |
| 578 | <i>Hungari miconodance</i>, a lethal species of bacteria to mice, was grown in a lab. The bacterium… |
| 581 | A point mutation in TrpC would… |
| 582 | Under what conditions would the lac operon be expressed in <i>E. coli</i>?… |
| 584 | While mutations are rare, changes to an organism's DNA sequence do occur. Of the following, which is… |
| 586 | Consider the <i>Staphylococcus aureus </i>model of quorum sensing. If the <i>agrA</i> gene is altere… |
| 587 | Which of the following is TRUE for processes carried out by microbes in soil environments?… |
| 589 | If there was a mutation in quorum sensing system of <i>S. aureus</i> inhibiting AgrC from phosphoryl… |
| 591 | Recent work by scientists has discovered a microbe in a cave. They want to identify what this microb… |
| 592 | You want to fix a pyrimidine dimer mutation, which of the following is the best system for repair?… |
| 593 | What type of RNA bonds to mRNA and disrupts the translation in a cell?… |
| 594 | The <i>symE</i> gene of <i>E. coli</i> causes the degradation of all mRNA. The <i>symR</i> encodes a… |
| 595 | Northern Minnesota is known for having beautiful lakes with little algae, deep, clear water, and san… |
| 597 | Which of the following uses the bioinformatic definition of a species?… |
| 598 | In order for Transcription to occur in the Mal operon, which of the following events need to occur.… |
| 600 | Which of the following is false in regards to the primary producers in acid mines?… |
| 601 | A mutagen that causes various modified bases would most likely use what method to repair the DNA?… |
| 602 | What would be a possible outcome of a mutation of sequence #2, so that it could no longer hybridize … |
| 603 | What happens if you remove the secondary structure of RpoH gene during heat shock?… |
| 604 | Which of the following statements is true about Oligotrophic, Mesotrophic, and Eutrophic lakes?… |
| 605 | What is the phenotypic consequence a mutation that removes LuxAB in quorum sensing for <i>Vibrio fis… |
| 608 | Scientists recently discovered a protein in <i>E. coli</i> that provides antibiotic resistance to Ci… |
| 610 | What is the major difference between chromosomes and plasmids?… |
| 611 | In catabolite repression, a cAMP-CAP complex is required to be present, if a mutation occurred and t… |
| 612 | If you wanted to design an experiment to survey the number of types of bacteria in a particular pond… |
| 614 | Which cellulose degradation system allows the organism to obtain glucose most efficiently?… |
| 616 | Light-sensitive pigments include _____(1)_____, and bacteriorhodopsin contains _____(2)______.… |
| 617 | You have an E. coli strain that contains a frameshift mutation in the CRP gene (also known as CAP). … |
| 619 | Which of the following is NOT an approach ecology takes to explain microbes interactions and distrib… |
| 620 | Which of the following is NOT an approach ecology takes to explain microbes interactions and distrib… |
| 621 | Which of the following qualities of chemolithoautotrophs makes it possible for chemoheteroorganotrop… |
| 622 | In Quorum sensing in <i>V. fischeir</i>, when the concentration AHL is high, this causes...… |
| 623 | What nitrogen compound is used as an electron acceptor in both denitrification and the anammox react… |
| 624 | Deletion of the <i>trpR</i> gene of the tryptophan operon would… |
| 625 | In the <i>trp</i> operon of an <i>E. coli</i> cell, you have a double mutant. One mutation is a dele… |
| 628 | As you were walking through the woods one day you come across a soil that is bright pink. You collec… |
| 629 | Which of these statements is TRUE concerning horizontal gene transfer?… |
| 632 | A group of scientists is studying a strain of <i>E. coli</i> which was exposed to radiation and deve… |
| 634 | Why is cellulose degradation using cellulosomes so effective?… |
| 635 | What type of mutation is caused by an addition or deletion of a base in a polypeptide-encoding part… |
| 636 | Which of the following is true about negative regulation?… |
| 637 | If <i>Vibrio fishcheri</i> had a mutation that deactivated luxl activity, the phenotypic outcome wou… |
| 638 | The function of _____________ is to disrupt translation by binding to mRNA.… |
| 639 | Which of the following is NOT an example of Transformation in horizontal gene transfer?… |
| 640 | In antisense RNA, the difference between cis and trans transcript regulators is that:… |
| 641 | Which of the following is correct?… |
| 642 | What is the correct scenario in which the trp operon becomes transcribed?… |
| 643 | Which of the following would be least likely to be used as an electron donor by a microorganism livi… |
| 644 | What is the purpose of using free radicals for the degradation of lignin in fungus?… |
| 646 | What happens when antisense RNA does not bind well to its target?… |
| 647 | Which of the following is NOT a characteristic of the plasmid to ensure that it is passed on to the … |
| 651 | You are a first year graduate student at the University of Hawaii in Maui, soaking up sun, culture a… |
| 652 | You have just returned from a trip for which you have obtained organisms living in the same habitat … |
| 653 | How can chemoheteroorganotrophs live in the deep sea?… |
| 654 | While plasmid segregation works to ensure that most offspring receive a copy of the plasmid, either … |
| 656 | Why would a tube worm die if a respiratory poison were introduced to it?… |
| 657 | There are 2 types of negative regulation. What makes Induction different from repression?… |
| 661 | With catabolic operons, excess of substrate will will trigger the ____ of catabolic enzymes, while i… |
| 662 | In nitrogen fixation, _________________ is converted to ammonia. This requires energy in the form of… |
| 663 | If you compare the ammonia-oxidizing bacteria to Nitrite-oxidizing bacteria, one thing they have in … |
| 664 | You are investigating farm fields in northern Scotland that do not respond to fertilization with amm… |
| 665 | Methylotrophs are chemolithoautotrophs. They generate their ATP and reducing power using methane as … |
| 666 | What product of symbiotic methanotrophs metabolism is of interest to the sphagnum moss?… |
| 667 | You have a strain that has been engineered to produce diesel fuel. You want to test several of the p… |
| 668 | In acetogens, a common electron donor is hydrogen, and the electron acceptor is carbon dioxide. Howe… |
| 669 | An interesting feature of acetogenesis that is not found in methanogenesis is that… |
| 670 | In the rumen, the carbohydrates ingested are converted by the microbial flora into _____________ for… |
| 671 | Primary symbionts are found in many insect species. These microbes… |
| 672 | There are all sorts of metabolic partnerships in the environment. In all cases,… |
| 673 | <i>Syntrophomonas</i> oxidizes butyrate anaerobically, producing acetate as an end product in the fo… |
| 674 | In the Beowolf digger wasps the Actinomycetes that grow on them are… |
| 675 | In modern microbiology, when investigating a holobiont, the microbial partners of a host are often d… |
| 676 | Which one of the following is not a role of the human microbiota… |
| 677 | If you examine the normal human microbiota of the skin… |
| 678 | One contributing factor to obesity is the host microbiome. This is thought to be true because… |
| 679 | The presence of <i>Akkermansia muciniphila</i> in human gut… |
| 680 | The gut microbiome has been found to have a role in heart disease (cardiovascular disease). This is … |
| 681 | The complement cascade can be triggered by… |
| 682 | Microbe-associated molecular patterns (MAMPs) are recognized by… |
| 683 | One of the reasons the skin is such a difficult system to penetrate is… |
| 684 | Once a pathogen is ingested into a phagocyte, the phagosome fuses with the lysosome. Which of the fo… |
| 685 | A critical part of the innate immune response that focuses the rest of the immune system on the path… |
| 686 | These are small proteins and peptides created by various immune cells to communicate with other cell… |
| 687 | Which of the following statements about adaptive immunity is false?… |
| 688 | Which one of these cells types has roles in both the innate and adaptive immune response?… |
| 689 | You are in the process of being infected with <i>Streptococcus pyogenes</i>. Certain cells obtain pi… |
| 690 | Of the following places, presentation of an antigen to the immune system would most likely occur in … |
| 691 | Once present in the lymph node, antigen will be exposed to various cells and will activate ________ … |
| 692 | Most activated B-cells will differentiate into… |
| 693 | T-cell receptor is to T-cell as __________ is to B-cell… |
| 694 | A virally infected cell signals to the immune system that it is infected by… |
| 695 | The cell that will respond to a virally infected cell and induce it to enter apoptosis is a… |
| 696 | The human immune system can respond to millions of different antigens. Part of this diversity in the… |
| 697 | Antibodies inhibit or kill pathogens by… |
| 698 | An epidemic of dancing flubitis has overtaken Madison. Victims get an overwhelming urge to perform t… |
| 699 | The difference between a pathogen and a commensal microorganism… |
| 700 | A crazy billionaire has dared you to drink a bacterial toxin and is willing to pay you $100,000 if y… |
| 701 | The disease is caused by a DNA virus and can lead to transformation of cells to cause cancer. The ca… |
| 702 | Rounds of repeated lysis of red blood cells lead to cyclic symptoms in this vector-borne disease. Th… |
| 703 | Using a microbiota transplant has been an effective means of treating the disease caused by this bac… |
| 704 | This common sexually transmitted infection that is spread by elementary bodies and replicates using … |
| 705 | A difference between rhinovirus and influenza virus is… |
| 706 | The influenza virus that arose in 2009 (H1N1) was of great concern for its potential to cause a pand… |
| 707 | Prion diseases when compared to other infectious disease are unique because… |
| 708 | This virus replicates by having it's (+) strand RNA virus made into a polyprotein that is then degra… |
| 709 | EHEC attaches tightly to the… |
| 710 | When humans shifted from hunter-gatherer societies (HGS) to agricultural societies (AS), epidemics i… |
| 711 | John Snow's experiments near the Broad Street Pump demonstrated… |
| 712 | Ciprofloxacin a fluoroquinolone targets… |
| 713 | You are tracking an epidemic. At the right are the results showing the incidence of the disease over… |
| 714 | You need to stop an influenza pandemic of a new deadly strain of the virus. Some politicians are pro… |
| 715 | Vaccines have been developed against numerous diseases. One of the below statements describes a vacc… |
| 716 | There are individuals in our society who cannot be vaccinated against certain diseases or many disea… |
| 717 | Looking at the graph on the right, which public health intervention do you think would be most usefu… |
| 718 | Which of the following is FALSE regarding disease?… |
| 719 | What phagocytic cells are the first to be recruited to an infection?… |
| 720 | What phagocytic cells are responsible for removing our own dead cells when they reach the end of the… |
| 721 | A steak loving man was found to have high levels of TMAO in his blood. In order to resolve this prob… |
| 723 | In mice fed dietary choline, it was discovered that increased labeled TMAO was produced. These mice … |
| 724 | The oral cavity and the lower GI tract both contain large microbial populations. What two shared pro… |
| 725 | Under what conditions do acetogens become the dominant consumer in an environment?… |
| 726 | How does the immune system distinguish between foreign cells and your body's own cells?… |
| 727 | Which of the following best explains how the complement system destroys foreign microbes?… |
| 728 | If all microbes were removed in a human, what be the effect on the immune system?… |
| 729 | In order for a pathogen to cause disease in a host, it must avoid the host immune system. All of the… |
| 730 | One way a pathogen could outsmart the adaptive immune system would be to use… |
| 731 | Neutrophils are best described as being:… |
| 732 | If a virus, such as HIV, destroys the body's T-lymphocytes, to which type of diseases would the pati… |
| 733 | Which of the following is true regarding passive and active immunity?… |
| 734 | Which of the following is not part of T cell activation and killing?… |
| 735 | Which of the following is a potential complication of Chlamydia infection in humans?… |
| 736 | What is a major difference in <i>Chlamydia trachomatis</i> and <i>Plasmodium</i>?… |
| 737 | Which of the following factors could be used used by pathogens to avoid the innate immune system. … |
| 738 | If someone accidentally fell into a pool of ethanol killing all of the microbes living on the surfac… |
| 740 | If you look at the above challenges to the immune system in which one does humoral immunity play the… |
| 742 | Which of the following statements accurately depicts a form of the adaptive immune response?… |
| 744 | <i>Chlamydia trachomatis</i> is a very prevalent disease that can cause sterility in women. What is … |
| 745 | Which of the following would be an example of a disease reservoir?… |
| 748 | Which of the following statements is FALSE when comparing <i>Clostridium difficile</i> (CD) to <i>Es… |
| 749 | If someone uses a needle to inject heroin and then passes it to his friend to use immediately after… |
| 750 | A particular environment is abundant in both methanogens and acetogens. There is little aerobic resp… |
| 751 | What purpose does that capsule serve in fending off the immune system of the host?… |
| 752 | Which of the following is FALSE regarding the microbe <i>Staphylococcus</i>?… |
| 753 | If a virus infects an mucosal epithelial cell in the human body, which of the following events is li… |
| 755 | Which of the following is a possible way a microbe would be able to survive inside a phagocyte?… |
| 756 | Which of the following statements are true regarding the oral cavity and oral microbiota?… |
| 757 | Which option lists the events of <i>Plasmodium</i> life cycle in the correct order? 1) Sporozoites… |
| 759 | Which of the following about EHEC (Enterohemorrhagic E. coli) is false?… |
| 761 | Which of the following is an example of syntrophy?… |
| 762 | Explain how an microbe could survive inside a phagocyte.… |
| 764 | All of these are correct about disease, except:… |
| 765 | Human Papillomavirus (HPV) can progress to cervical cancer in women by… |
| 766 | What stage of development of the protozoan pathogen <i>Plasmodium falciparum</i>, transmitted by <i>… |
| 768 | Skin tissue has become swollen, red, hot, and painful. This is because:… |
| 769 | Which microbe can be sexually transmitted?… |
| 770 | What is the purpose of secondary immune tissue, such as the lymph nodes?… |
| 771 | A microbe causes a disease in humans, but only when the host has recently been victim to a bad burn … |
| 772 | A microbe is a resident of 50% of individuals, yet sometimes causes infection. This is an example of… |
| 774 | The complement proteins are produced in all of the following EXCEPT:… |
| 775 | A patient comes into the Emergency Room with a red bull’s eye rash with flu like systems. After ques… |
| 776 | Which disease is the main cause of infectious diarrhea after hospitalization and antibiotic use?… |
| 777 | Danio rero fish ( Zebra fish) develop abnormalities when they are raised in a germ-free environment … |
| 778 | If Methanogens and acetogens are both in an environment at with low substrate concentrations (carbon… |
| 779 | A young woman’s Pap smear showed aberrant cells. This created concern that she may later develop cer… |
| 780 | Which of the following functions would most likely continue to occur normally after the removal of t… |
| 781 | Which of the following is <b>not</b> an example of microbial metabolic partnerships (syntrophy)… |
| 782 | When <i>Staphyloccocus epidermidis</i> infects the skin of a healthy individual this is an example o… |
| 783 | What sexually transmitted disease is the cause of cervical cancer in women and penile, anal, head, a… |
| 784 | Individuals that lack <i>Akkermansia muciniphila</i> in their normal microbiota:… |
| 785 | Microbial partners play important roles in eukaryotes and prokaryotes, which is a benefit shared by … |
| 786 | EHEC uses a type III secretion system (T3SS) to...… |
| 787 | Why is <i>Borrelia burgdorferi</i> considered a primary pathogen?… |
| 788 | Which section of the GI tract has the most conserved microbiome between individuals, plays a role in… |
| 790 | An entity recognizes a foreign antigen displayed on a MHCI complex of a cell infected with an intrac… |
| 791 | You want to conduct a study to determine if lack of <i>Akkermansia muciniphila</i> causes disease or… |
| 792 | How do pathogens use secretion systems?… |
| 793 | In comparing all the diseases we covered in lecture, which bacterium behaves most like a virus?… |
| 794 | Mike has noticed a bull's eye-like rash on his leg and has a fever and other flu-like symptoms for t… |
| 796 | Just outside of Madison, there are several farms that specialize in growing soybeans. A microbiologi… |
| 797 | Which of the following is an example of an exotoxin producing cells that makes Shiga Toxin and how d… |
| 798 | A major difference between Chronic Wasting Disease and Human papillomavirus is...… |
| 799 | What is an example of a adherence factor used to facilitate attachment of a microbial pathogen to ho… |
| 800 | A pathogenic microorganism has infected a host and is causing extensive damage by inhibiting protein… |
| 801 | In which of the following ways would humans be harmed if mutualistic bacteria were removed from the … |
| 802 | What systems or organs in the body do not contribute to the immune system?… |
| 803 | Why do lipids make poor antigens?… |
| 804 | Treatment with cephalosporins is correlated with infection with <i>Clostridium difficle</i>. This is… |
| 805 | When comparing the oral microbiome to the rest of the GI tract it is distinct in that… |
| 806 | The GI microbiome of a cow has a more profound impact on their nutrition than in humans. However, th… |
| 808 | Which of the following can serve as adherence factors to facilitate attachment of a microbial pathog… |
| 809 | Vegans, when fed a steak dinner, do not have a spike in TMAO. Meat eating individuals, when fed the … |
| 810 | Toxic shock syndrome is caused by what microbe?… |
| 811 | A person is at risk of a nosocomial infection, such as MRSA, in which of the following settings:… |
| 814 | Enterohemorrhagic <i>E. coli</i> (EHEC) violates Koch's postulates for pathogen categorization becau… |
| 815 | Which of the following is FALSE about inflammation?… |
| 817 | How is the metabolic role of microbes different between humans and ruminant animals?… |
| 818 | Tara, a vegan, goes to a cocktail party and decides today is the day she will consume red meat! Afte… |
| 819 | Two microbes are isolated and found to be in a cooperative producer-consumer relationship in which t… |
| 820 | Why is Influenza difficult to develop a permanent vaccine for?… |
| 821 | Which of the following is not an example of a virulence factor in <i>Salmonella enterica</i>?… |
| 822 | All of the following are reservoirs except:… |
| 824 | Which of the following is a virulence factor of <em>B. burgdorferi</em>… |
| 825 | What is the difference between an endotoxin and a exotoxin?… |
| 826 | Which one of the following would never be considered a virulence factor?… |
| 827 | Which of the following is not a protozoa that can cause malaria?… |
| 829 | Which type of immune response listed below is not inducible?… |
| 831 | What are the differences between endotoxins and exotoxins?… |
| 832 | Which of the following diseases is NOT potentially caused by <i>Staphylococcus aureus</i>?… |
| 833 | You discover a pathogen that you suspect is causing a disease outbreak. In order to identify the cau… |
| 834 | If all microbes were to be removed from humans, which of the following would be some common repercus… |
| 835 | When developing a preventative vaccine that trains your immune system to recognize a particular viru… |
| 836 | You are experiencing abdominal pain and bloody diarrhea. Which of the following organisms could you … |
| 837 | What is false about antibodies?… |
| 839 | An example of an exotoxin is the ______, and it causes damage to a host by ______.… |
| 840 | Which of the following is not a phagocyte?… |
| 845 | Which of the following is false regarding chlamydia?… |
| 846 | Which of the following is an example of a function of a symbiotic microbe?… |
| 848 | A major similarity of the oral cavity and the lower GI tract is..… |
| 849 | What are the role(s) of mutualistic microbes?… |
| 850 | A characteristic of <i>Borrelia burgdorferi</i> that makes the microbe particularly dangerous is...… |
| 852 | What is NOT a symptom of EHEC?… |
| 853 | After a long day of studying microbio, you walk home and fall out of utter exhaustion, injuring your… |
| 854 | You are investigating two organisms and trying to determine their form of respiration based upon the… |
| 855 | Which statement below is true?… |
| 856 | A(n) ___________ pathogen can live in its host and never cause any trouble, while a(n) ____________ … |
| 857 | If all of microbiota is removed from the human body which of the following functions would be affect… |
| 858 | If the amount of phosphatidycholine (meat) taken into the body was reduced, what would happen to the… |
| 859 | Which of the following is not a mechanism used by your body to detect and respond to presence of a p… |
| 860 | Which of the following about complement is false?… |
| 862 | Which of the following is not an example of the effects of dysbiosis in humans?… |
| 864 | The target of macrolide antibiotics, such as erythromycin, is… |
| 865 | An epidemic of cholera has broken out in the Sellery Dorm. Students are dropping like flies and you,… |
| 866 | A new potentially pandemic strain of influenza virus has just begun in Madison. Patients that have b… |
| 868 | Preventing diphtheria infection is best done by… |
| 869 | You ate some under cooked hamburger that was made up of ground meat, and now you are ill with Entero… |
| 870 | There has been a dramatic decrease in deaths due to infectious disease in the 20th century. This can… |
| 872 | A new disease is spreading across the upper midwest. You are unsure if this is caused by a infected … |
| 873 | A nationwide epidemic of Salmonellosis has been reported, with cases occurring in 46 states. After e… |
| 874 | There is a higher incidence of infectious disease today than in 1900… |
| 875 | The most commonly produced antibiotics are… |
| 876 | Fluoroquinolones mode of action is… |
| 877 | Rifampicin's mode of action is… |
| 878 | Which of the following is not a mechanism that bacteria use to become resistant to an antibiotic?… |
| 879 | Why is it sometimes difficult for your immune system to distinguish between self and non-self?… |
| 880 | An important difference between humoral immunity (B cells) and cell-mediated immunity (T cells) is…… |
| 881 | Of the statement's below which is LEAST likely to apply when discussing Humoral Immunity?… |
| 882 | You have <i>E. coli</i> (EHEC). You are prescribed an antibiotic. What would be wrong with this trea… |
| 883 | Your doctor tells you that you have an elevated risk for CVD. There is a way to lower this risk by c… |
| 884 | Which of the following is NOT a way to directly transmit a pathogen to another person?… |
| 885 | The immune system is able to react to and destroy foreign microorganisms that enter the body, but do… |
| 886 | Which of the following is not one of Koch's postulates?… |
| 887 | Which of the following is FALSE about chronic wasting disease?… |
| 890 | What is the difference between innate immunity and adaptive immunity?… |
| 891 | Which of the following statements is incorrect in regards to microbe survival inside a phagocyte?… |
| 892 | Which of the following is not a similarity between methanogenesis and acetogenesis?… |
| 893 | What is a reason why the epithelial barrier is an effective first barrier to pathogens in the innate… |
| 894 | Chronic wasting disease (CWD), a common infectious disease found in many species of deer and elk wor… |
| 895 | Which of the following is not correct about the complement system?… |
| 897 | Which barrier listed below is NOT a barrier a pathogen would need to overcome to evade the innate im… |
| 898 | In what tissue/skin cells are infectious HPV viral particles released?… |
| 899 | A substance is creating a pore in the cell membrane, what could be the cause?… |
| 900 | Which combination of molecules detected match the corresponding pattern of recognition (Microbe Asso… |
| 901 | Which of the following steps in Influenza A virus replication is not accurate?… |
| 902 | How does Chlamydia enter the host?… |
| 903 | LPS is an example of ____. It causes damage to the host by ________… |
| 904 | Which form of Plasmodium is associated with symptoms of malaria in the blood phase?… |
| 905 | Until complement proteins are activated they _________?… |
| 906 | Which of the following situations would result in a TMAO spike?… |
| 908 | A disease can only be caused by...?… |
| 910 | Which one of the following is not a symptom of CWD?… |
| 912 | Which of the following is true regarding the influenza virus?… |
| 913 | Which of the following is one way a microbe could survive inside a phagocyte?… |
| 915 | <i>Staphylococcus epidermidis</i> is a common member of the skin microbiota that colonizes many site… |
| 916 | The use of antibiotics on farms to promote more rapid growth of livestock is an important health iss… |
| 917 | The rise of a superbug resistant to all know antibiotics is probably inevitable because… |
| 918 | Which of the following is the most inclusive definition of a vaccine?… |
| 919 | Which of the following does not have an effective vaccine… |
| 920 | Vaccines are required by public health departments nationwide before you can enroll your child in pu… |
| 921 | All of the following are virulence factors. Which one serves a purpose specifically different from t… |
| 922 | An unusual gastrointestinal illness has hit the Midwest. The symptoms include diarrhea, vomiting, an… |
| 923 | Hemorrhagic <i>E. coli</i> (EHEC) causes disease, while <i>E. coli</i> (NEC) is also part of our nor… |
| 924 | Recently, strains of Methicillin-resistant <em>Staphylococcus aureus</em> (MRSA) are capable of grow… |
| 925 | Generally, RNA in the cell is single-stranded, while DNA is double-stranded.… |
| 926 | The DNA double helix is stabilized by.… |
| 927 | One reason DNA serves to store hereditary material instead of RNA because.… |
| 928 | The steps of transcription, in order are.… |
| 929 | If you removed the -10 region of the promoter region that sigma-70 RNA polymerase recognizes, the ge… |
| 930 | You have a sigma-70 promoter that matches the consensus sequence for that promoter. If you made a ch… |
| 932 | Here is a DNA sequence that is known to code for the end of a mRNA. Does this sequence have a rho-i… |
| 936 | The carbonyl linkage is a key component of esters found in cell membranes. A newly discovered toxin … |
| 937 | Which of the following is NOT a reason why DNA is used to store hereditary information instead of RN… |
| 938 | Which of the following is correct regarding the helpful or harmful effects of microbes?… |
| 939 | Microbes have many impacts on the environments and on humans themselves, which of the following is f… |
| 940 | A microbe exhibiting chemotaxis should do which of the following when a positive stimulus is introdu… |
| 941 | Which of the following is NOT true when regarding chemo taxis?… |
| 942 | Which of the following is TRUE with regard to cellular transport processes?… |
| 946 | With a living microbe that may be transparent, which type of microscope will provide a higher qualit… |
| 947 | Match the microbe with its preferred source of electrons… |
| 948 | Topi is a protein that recognizes testis-specific genes of Drosophila (fly). Topi's primary focus is… |
| 949 | You are buying a replacement filter for your 12 Survivors Hand Pump Water Purifier. You can get cera… |
| 950 | Microorganisms make your life better in many ways. Which of the following is a correct statement the… |
| 951 | A major difference between the hydrogen and covalent bonds found within the DNA double helix is that… |
| 952 | In another landmark experiment of Louis Pasteur, he demonstrated that injecting chickens with a weak… |
| 954 | If a bacteria with a flagella is in the presence of a positive stimuli it will… |
| 955 | Why is oxygen critical for aerobic respiration?… |
| 956 | Ciprofloxacin is known to inhibit DNA helicase of bacteria. If you could label the molecule and iden… |
| 957 | You have a Gram-stained smear from a patient that has a bacterial infection. What scope would you us… |
| 958 | A research group has developed a new antibiotic that kills the enzyme that synthesizes lipid A. This… |
| 960 | A microbe can no longer transport alanine. You find that this transporter has lost its ability to bi… |
| 961 | Which of the following is unique to the Gram-positive cell wall structure… |
| 962 | You isolate an organism that is capable of spreading across the plate. Electron microscopy confirms … |
| 963 | You are a rising star in the field of microbiology and after discovering a new microbe, you want to … |
| 964 | RNA is not commonly used for information storage due to its instability. For a virus with negative s… |
| 965 | DNA uses the nucleotide thymine to base pair with adenosine. RNA is transcribed using uracil instead… |
| 966 | Which is most likely to show there is an increase in the rate of a reaction forward?… |
| 967 | DNA contains triplet codons that code for specific amino acids. How are you able to distinguish amin… |
| 968 | Which statement about DNA is incorrect?… |
| 969 | Which of the following is NOT a way to distinguish DNA from RNA?… |
| 970 | Why is DNA used to store hereditary information?… |
| 971 | In bacteria, the cytoskeleton is composed of protein filament structures that are often involved in… |
| 972 | Transport proteins are often used to transport molecules through the cell membrane, how do some mole… |
| 974 | Predict the order of the following reactions: Pyruvate + 2H+ + 2e- -> lactate cytochrome b (Fe3+)… |
| 975 | Which of the following about the Gram Staining process are true?… |
| 976 | You have isolated an unidentifiable cell and your task is to determine what domain this cell belongs… |
| 977 | What is one way in which Archaea can be distinguished from Bacteria and Eukarya?… |
| 978 | Why was there a big time gap between when Thonis Philipszoon discovered microbes and when we began t… |
| 979 | All of the following are true statements about the bacterial membranes except… |
| 980 | The lab that you work in just discovered a new bacterium. Your goal is to first visualize the bacter… |
| 982 | In an experiment, white and black mice were exposed to staphylococcus bacteria. The white mice have… |
| 983 | How is ATP produced in substrate-level phosphorylation?… |
| 984 | You discovered a strange microorganism. You want to first examine the motile microorganism in its na… |
| 988 | Which of the following is FALSE when referring to the Peptidoglycan of a bacterium?… |
| 989 | Given the components of the electron transport chain and their reduction potentials, what is the cor… |
| 990 | Given the components of the electron transport chain and their reduction potentials, what is the cor… |
| 991 | A microbe using chemotaxis changes its direction of motion by… |
| 992 | If DNA is used to store information for many organisms, what statement is INCORRECT about the RNA us… |
| 993 | In the cell, substrate level phosphorylation (SLP) can occur:… |
| 994 | Which is false of substrate-level phosphorylation?… |
| 995 | For a typical table vinegar, about 5% to 8% of the content is acetic acid, which is produced by acet… |
| 996 | A researcher discovers a new organism with a unique electron transport chain. After investigating th… |
| 997 | There was a large gap of time between being able to see microorganisms and being able to cultivate a… |
| 998 | Identify the protein sequence from the following mRNA code. Is the sequence positively charged, neg… |
| 999 | Which of the following is ordered correctly from largest to smallest?… |
| 1000 | Bre, as the frugal college student she is, tried to save some money by brewing her own Kombucha, the… |
| 1001 | What properties of agar make it a better media for culturing microbes than gelatin?… |
| 1003 | Looking for something fun to do, you decide to compare the relatedness of Gram-positive and Gram-neg… |
| 1005 | Which of the following is TRUE of BOTH alcoholic fermentation of glucose performed by yeast and oxid… |
| 1006 | Why do active transport processes, ie proton pumps, require energy, while passive transport, ie diff… |
| 1007 | Consider the following reaction: 2Ag+(aq)+Cu(s)⇌Cu2+(aq)+2Ag(s) Identify which substrate is being … |
| 1008 | Consider the reaction pathway<br /> <img src="http://www.microbiologytext.com/images/book_5/chapter… |
| 1011 | Which of the following statement(s) is/are true regarding the structures of DNA and RNA. I. DNA ha… |
| 1015 | Consider the formation of lactic acid (via the homofermentative pathway) <img alt="The homofermentat… |
| 1017 | Which of the following correctly matches the scientist to the contributions they made for microbiolo… |
| 1019 | In your research lab, you are studying the outer membrane of a new bacterial species <i>Microbius ba… |
| 1020 | Gram-negative bacteria can release endotoxins but Gram-positives cannot, because… |
| 1021 | You discover a new bacterium that uses oxygenic photosynthesis instead of anoxygenic photosynthesis.… |
| 1023 | Which term does NOT describe retinal-based phototrophy?… |
| 1024 | You discover a new organism that is very similar to other organisms; it has cytochrome b and cytochr… |
| 1026 | Which of the following components or bacteria are not associated in retinal-based phototrophy?… |
| 1027 | Which of the following is not a way that microbes impact our lives?… |
| 1029 | Given the major components of an electron transport chain, and their order, explain why they are in … |
| 1030 | A toxin is introduced into a cell where it causes quinones to be unable to bind to the b/c1 complex … |
| 1032 | You are attempting to determine whether a microorganism belongs in the Bacteria, Archaea, or Eukarya… |
| 1034 | The start of the citric acid cycle begins with pyruvate dehydrogenase, where Pyruvate is converted i… |
| 1036 | Which of the following arrangements of the molecules A-D could be used in an electron transport chai… |
| 1037 | A mutant <i>E. coli</i> has been discovered to create defective MreB cytoskeletal proteins at higher… |
| 1038 | A mutant E. coli has been discovered to create defective MreB cytoskeletal proteins. Which of the fo… |
| 1039 | What is the most important result of Tom Brock's research in Yellowstone National Park?… |
| 1042 | Which of the following would result as a consequence of the inhibition of the Na+/K+ ATPase pump in … |
| 1043 | Which of the following statements is correct regarding the process of phototphosphorylation in Purpl… |
| 1044 | Which of the following statements is correct regarding the process of phototphosphorylation in Purpl… |
| 1045 | A major difference between a Eukaryota cell structure and bacterial cell structure is that _________… |
| 1046 | One major difference between Bacteria and Eukaryota is that __________… |
| 1047 | Bacterial DNA must be contained within the nucleoid. One factor in DNA organization is… |
| 1048 | Why is DNA used for hereditary information rather than RNA?… |
| 1049 | Most prokaryotes are capable of using fermentation to produce a variety of energy-yielding products … |
| 1050 | What is a major similarity between photosynthesis and retinal-based phototrophy?… |
| 1051 | Which of the following is true regarding Substrate Level Phosphorylation (SLP) and Oxidative Level P… |
| 1053 | Everything is true regarding Substrate level phosphorylation (SLP) and Electron transport level phos… |
| 1054 | Which of these pathways contain a redox reaction?… |
| 1055 | A mutation changes the first A in the Pribnow box to a guanine in a bacterial promoter region of a … |
| 1057 | What is the role of oxygen in aerobic respiration?… |
| 1058 | A bacterial cell with flagella is moving freely through an environment is attracted by a newly intro… |
| 1059 | Translate this mRNA transcript into its amino acid sequence: 5'-AUG CUA UGU CCC GCC AGU UAU UGA-3'… |
| 1060 | Throughout history, beer was made by leaving grains in a covered, sealed container for a long period… |
| 1062 | Which of the following are consistent with the process of alcoholic fermentation, as utilized by org… |
| 1063 | Which choice best describes the relation between the photosynthetic apparatus for all microbes and p… |
| 1065 | Which of the following is the correct sequence of events that occurs to get protons pumped across th… |
| 1068 | Which half reaction is most likely to donate electrons to other molecules and why?<br /> <img src="… |
| 1069 | The electron transport system generates an electrochemical gradient of protons, which ATP synthase c… |
| 1070 | Why would RNA not be a good hereditary material compared to DNA?… |
| 1071 | Why would microbes prefer smaller sizes to bigger sizes?… |
| 1073 | Which of the following best describes the accuracy of the relationship between light harvesting-comp… |
| 1074 | The following components are part of an electron transport chain. Given their reduction potentials,… |
| 1075 | H+ are pump out of the cytoplasm towards the outer membrane of a Gram-negative bacterial cell becaus… |
| 1076 | Which of the following correctly matches the structures with their location and composition?… |
| 1081 | Which of the following statements fits the best description of purple bacteria?… |
| 1082 | The fermentation process used to create alcoholic beverages consists of two major steps. Oxidation t… |
| 1083 | All of the following are true about fermentation pathways EXCEPT:… |
| 1084 | Which of the following is not a reason that DNA is used for hereditary information instead of RNA?… |
| 1085 | The flow of electrons within the electron transport chain is coupled to the creation of ATP. If ther… |
| 1086 | Which of the following is a major similarity between chlorophyll and heme?… |
| 1088 | Which of the following is the correct translation of the mRNA sequence into amino acids? <br />AUG … |
| 1091 | Green bacteria collect light using a chlorosome. The analogous structure in Purple bacteria is… |
| 1092 | What discovery allowed us to finally characterize microbes, despite them being discovered by Thonis … |
| 1093 | Which of the following is a difference between the roles of Fe and Mg in enzyme catalysis?… |
| 1094 | A cell carries out an energy yielding metabolic process that produces ethanol. During this this pro… |
| 1095 | Which of the following statements is NOT true about the process of Lactic Fermentation?… |
| 1096 | Which of the following is not a function of a cell membrane?… |
| 1098 | Which of the following would not be a good example of an electron acceptor in a respiratory pathway?… |
| 1099 | What is a characteristic that retinal-based phototrophy and classic photosynthesis light reactions s… |
| 1100 | Which of the following regarding Gram-positive and Gram-negative Bacteria is INCORRECT?… |
| 1101 | How is the electron transport chain used in the photosynthetic apparatus?… |
| 1102 | A major difference between Homofermentation and Heterofermentation is… |
| 1103 | Oxidative phosphorylation creates an electrochemical gradient by the direct oxidation of...… |
| 1104 | For the General Equation 2A + B -> C, given the following concentrations, which direction will th… |
| 1106 | The potential energy created by a hydrogen gradient is used to make ATP. Which of the following is … |
| 1107 | Where do oxidative phosphorylation and substrate-level phosphorylation get their energy from?… |
| 1108 | Why didn't microbiology immediately become a thing after Thonis Philipszoon observed microbes?… |
| 1111 | Which of the following amino acid sequences represents the translation of the mRNA molecule below? R… |
| 1112 | How does a standard Gram staining process differentiate between Gram-positive and Gram-negative bact… |
| 1113 | Which of the following is NOT true of both flagella and pili?… |
| 1114 | In aerobic respiration _______ is oxidized, ______ is reduced, and ________ is the energy molecule … |
| 1115 | Which of the following reactions would most likely occur in a reaction center during the process of … |
| 1116 | Which of the following are not found in both Gram-negative and Gram positive cells?… |
| 1117 | You smear a petri dish with two different obligate phototrophs- a purple bacteria (B. Badger) and a … |
| 1118 | From the choices I. Purple Bacteria II. Heliobacteria III. Cyanobacteria IV. Green Bacteria … |
| 1119 | A prokaryotic organism is able to move randomly, but unable to escape a poison due to a mutated prot… |
| 1120 | As an important part of electron transportation, cytochromes contain what that binds an electron to … |
| 1121 | which of the following is an example of a redox reaction in the electron transport chain?… |
| 1122 | Which of the following statements is false about oxygenic and anoxygenic phosphorylation?… |
| 1124 | Which of the following is correct regarding the reduction potentials of the players in the electron … |
| 1127 | Who discovered the reason for wine souring and why was this discovery significant?… |
| 1128 | Which of the following are characteristics of oxygenic phosphorylation? I Oxygen is released as a b… |
| 1130 | Which of the followings is false concerning the roles of chlorophyll and carotenoids?… |
| 1132 | DNA's structure is characterized by all of the following EXCEPT:… |
| 1133 | Which of the following statements about the cell wall is correct.… |
| 1134 | Leptothrix discophora is a freshwater bacteria species known for its ability to use iron and mangane… |
| 1135 | Chemotaxis is the directed movement of an organism in response to a ________ stimulus. If an organis… |
| 1137 | Which molecule loses an electron in light-dependent reactions?… |
| 1139 | Substrate-level phosphorylation which leads to the formation of ATP by the process of transferring a… |
| 1140 | Your roommate is sick with the flu and is bashing microbes due to the fact that they caused her sick… |
| 1141 | The strands on a DNA double helix gain stability via ____________.… |
| 1142 | A major difference between Bacterial And Archaeal cells is that… |
| 1143 | Unlike RNA, DNA cannot undergo autocatalytic cleavage due to the fact that...… |
| 1146 | Consider transformation, transduction, and conjugation.What of the following statements is correct?… |
| 1148 | When using irradiation as a physical method to control microbial growth in food, which method would … |
| 1150 | Why might a certain strain of bacteria in the biofilm state be less susceptible to antimicrobials th… |
| 1151 | Which of the following statements is false regarding CRISPR cas9 technology?… |
| 1152 | Which of these organisms can be classified as photoheterotrophic organotrophs?… |
| 1153 | Identify the process of nitrogen fixation as oxidation or reduction, and why it is so.… |
| 1154 | Which of the following is false regarding the identification and prediction of ORFs and their functi… |
| 1155 | In a laboratory experiment, a transposon insertion in the <em>lac</em> operon is suspected to occur … |
| 1156 | Quorum sensing is advantageous to S. aureus in which situation?… |
| 1157 | What category of <i>elements</i> often find their use in enzymes as cofactors?… |
| 1158 | Your lab isolated a novel microbe that is the most populous bacterium found in the lake. It has neve… |
| 1160 | Griffith’s experiment with <em>Streptococcus pneumoniae</em> demonstrated which of the following abo… |
| 1161 | How can chemoheteroorganotrophs survive in the deep sea?… |
| 1162 | Which of the following genetic experiments is a screen?… |
| 1163 | All of these are necessary for anammox respiration EXCEPT:… |
| 1164 | which of the following statements is false, regarding plasmids and chromosomes… |
| 1165 | In which of the following cases should you use selection? a. To easily identify your mutant by ha… |
| 1166 | How is the quorum sensing system in Gram-positive Staphylococcus aureus advantageous to its survival… |
| 1167 | You discover a new bacteria while walking along a glacier in the Arctic region. When you place it in… |
| 1169 | If there was a mutation in MaIT of the Maltose operon such that it was no longer active, what would … |
| 1170 | As an experiment for a class, you decide you would like to perform a bacteriological water analysis … |
| 1171 | An mRNA strand contains a riboswitch which, when active, causes the Shine-Dalgarno sequence to form … |
| 1172 | You are trying to classify a species, however, the classic definition of a species and the bioinform… |
| 1173 | Which regulation category below best describes a system where a co-repressor is used to activate a r… |
| 1174 | If organisms capable of nitrification were to no longer exist, what would be a hypothetical impact?… |
| 1175 | Studying bacterial resistance, you manipulated conditions to force a species of bacteria to form end… |
| 1176 | A cell has an activator that has been mutated. The allosteric site of the activator will no longer b… |
| 1177 | You have isolated a strain of bacteria from the soil and have sequenced its genome. Which of the fo… |
| 1178 | Which statement INCORRECTLY describes assimilation of carbon dioxide into cell carbon?… |
| 1180 | Which type of strategy would you NOT use in milk preparation to minimize microbial growth during sto… |
| 1181 | The trp operon is a/n example of a _________while the lac operon is a/n _________. The substrate use… |
| 1183 | What happens if microogranisms in a biofilm are no longer able to secrete an exopolysaccharide… |
| 1184 | In the <em>agr</em> (accessory gene regulation) system of <em>S. aureus</em>, if AgrC is mutated and… |
| 1185 | A researcher is interested in locating a protease gene in the microbe Buckingham badgerii and predic… |
| 1187 | When calculating the growth rate of a given set of data, which option is <b>incorrect</b> when utili… |
| 1188 | Controlling growth by ionizing radiation or UV light are similar in the sense that they _________, a… |
| 1190 | Which of the following are true of both photosynthesis and rhodopsins? I. Utilize light to generate… |
| 1191 | Farmer Paustian’s germophobic cousin wrote in a letter that he would be visiting today to try … |
| 1192 | Bacteria in a medium culture tube is clear throughout the tube except for growth at the top of the t… |
| 1193 | Which of the following is NOT a technique we use to preserve food by minimizing microbial growth?… |
| 1194 | Enzyme A is allosterically inhibited by it's product when it is in high concentrations in the cell. … |
| 1195 | Which of the following are true of Antisense RNA?… |
| 1196 | A medium containing bile salts and crystal violet is made. It is later observed that Gram-negative b… |
| 1197 | A researcher wishes to determine which microbes on a plate are capable of fermenting lactose. After … |
| 1198 | Which of the following compounds can serve as terminal electron acceptors in the deep sea?… |
| 1202 | Staphylococcus aureus is a Gram-positive bacterium with an accessory gene regulation (Agr) system/qu… |
| 1203 | You just finished sequencing a section of double-stranded DNA from Bacillus badgerii. You have foun… |
| 1204 | If a mutation in the genes of <em>Staphylococcus aureus</em> causes AIP not to be made, which is mos… |
| 1205 | Which of the following is <strong>not</strong> a common characteristic among primary producers in an… |
| 1206 | Part of the nitrogen cycle involves nitrification which converts ____________, and a microbe that ca… |
| 1207 | You are designing an experiment to determine if the luxS gene is an essential gene for Lactobacillus… |
| 1208 | Which of the following is FALSE?… |
| 1209 | What is the growth rate of the culture from 1 pm (X0= 1E+5 CFU/mL) to 8 pm (Xt= 1E+9 CFU/mL) with a … |
| 1210 | Both Myxobacteria and Bacillus species form spores as a result of nutrient deprivation. Which of the… |
| 1212 | There is a mutation in the trpR gene that causes the gene to be deactivated by binding to tryptophan… |
| 1213 | Which of the following reactions do methylotrophs use to obtain energy and carbon?… |
| 1214 | In the SymE-SymR toxin-antitoxin system, SymE is a hydrophobic toxin and SymR is a non-coding RNA th… |
| 1215 | Your friend identifies a species using the classic definition, and you use bioinformatics. You both … |
| 1216 | You figure out your beer is infected with either E. coli (Gram-negative), Staphylococcus aureus (Gra… |
| 1217 | What is a distinguishing feature between plasmids and chromosomes?… |
| 1218 | Which of the following best explains why application of a respiratory poison to a tube worm would li… |
| 1219 | Which of the following is true about the ocean chemistry in deep sea ocean vents?… |
| 1221 | Denitrification occurs when there is inadequate _______ and a feasible amount of _______.… |
| 1222 | You have an allosteric protein that is activated when substrate A is bound to it. A molecule acts as… |
| 1223 | Which of the following scenarios would NOT lead to the restricted growth of a photoautotrophic litho… |
| 1225 | You mutagenize a culture with UV light and then plate it onto rich medium + rifampicin. After incuba… |
| 1226 | Which of the analogies is/are correct if the following are representative: an operon (DNA) is like a… |
| 1227 | What decreases the growth of bacteria, molds and yeast in honey and jam?… |
| 1228 | You want to remove bacteria from a liquid that is sensitive to heat. What would be the most effectiv… |
| 1229 | A mutation occurs so that that DnaK cannot bind tightly to RpoH (σ-32). Which of the following woul… |
| 1230 | If AIP is unable to bind to AgrC will the system still work for quorum sensing?… |
| 1231 | Some species of Serratia and Pseudomonas in the soil can deplete soil fertility and reduce agricultu… |
| 1232 | What would be the effect of a loss-of-function mutation to DnaK chaperone protein in a high-temperat… |
| 1233 | You have been growing organisms under strict nutrient conditions that allows some molecular organism… |
| 1235 | A major difference between sterilization and pasteurization is that:… |
| 1236 | Which of the following is false regarding the conversion of nitrogen to its various oxidation states… |
| 1237 | You are walking in a strange patch of woods and come upon a creature unlike you've ever seen before.… |
| 1238 | You have isolated a deletion mutation the malT gene in the maltose operon. What would the effect be … |
| 1239 | Methanotrophs live in symbiosis with sphagnum mosses where the contribution of each to this relation… |
| 1241 | What enzyme is involved in nitrogen fixation (1) and which type of bacteria need to form a heterocys… |
| 1242 | What is a major difference between photosynthesis and light driven proton pumps (rhodopsins)?… |
| 1243 | If there is a mutation that causes allolactose to not be able to bind to lacI (repressor protein), w… |
| 1244 | Which of the following statements is INCORRECT regarding photosynthesis and rhodopsins?… |
| 1248 | Nitrification plays an important role in Nitrogen Fixation. During Nitrification Ammonia is converte… |
| 1249 | <table class="table table-striped"> <thead> <tr> <th>Time</th> <th>Medium 1</th> <th>Medium 2… |
| 1250 | Conjugation is a form of ____ gene transfer. The recipient is captured and brought in contact with t… |
| 1251 | You are preparing to reuse a medical instrument and want to make sure it is sterile. To do this, you… |
| 1252 | When referring to attenuation in the regulation of the tryptophan operon it would be safe to say tha… |
| 1253 | Which of the following is NOT a group of organisms that can survive in deep sea ocean vents?… |
| 1254 | Due to the fact that the structure of lignin is randomly assembled and tough to degrade, how do fung… |
| 1255 | A lab grows a culture using a medium that is both selective and differential, which includes bile sa… |
| 1256 | Methanogens are anaerobic Archaea that reduce methanogenic substrates to methane, often using hydrog… |
| 1257 | Which of the following correctly describes the steps of nitrification and the microbes involved?… |
| 1259 | Which of these is a characteristic of both lake and ocean environments, but not of soil environments… |
| 1260 | What is Cas9 and what does it do?… |
| 1261 | CRISPR-CAS 9 gene editing is a way to edit genes in DNA. It functions in bacterial systems in a way … |
| 1262 | Which of the following typically consists of organic compounds?… |
| 1263 | While working in the lab you want to measure the growth rate of a planktonic microbial population co… |
| 1264 | Griffith's experiment with <i>Streptococcus pneumoniae</i> demonstrated which of the following?… |
| 1265 | Which of the following would be the best way to produce large quantities of a protein?… |
| 1266 | You are studying a microbe and would like to determine its nutritional classification. You have dete… |
| 1267 | Chemoheteroorganotrophs are able to live in the deep sea because:… |
| 1268 | You are working in a lab over the summer and inject groups mice with the following virulent <i>Strep… |
| 1270 | Why would a tubeworm die if given a respiratory poison?… |
| 1271 | A mutation occurs in LuxR of <i>V. fischerii</i> such that its activity decreases by a factor of 5 c… |
| 1272 | CRISPR Cas9 was discovered in E.coli as a type of bacterial immune system where sections of viral DN… |
| 1274 | How would the introduction of a chemical pollutant that inhibits the utilization of rhodopsins by mi… |
| 1276 | The area surrounding an old mine was found to contain acidic water with a pH between 0 and 1. A micr… |
| 1278 | Which part of the cellulosome functions in binding the catalytic enzymes to the scaffoldin?… |
| 1279 | You grow a bacteria and as expected, the bacteria grew under aerobic conditions. However under anaer… |
| 1280 | Biofilm and planktonic cells form aggregative structures during their life cycle in order to… |
| 1282 | Which of the following describes a symbiotic relationship between methylotrophs and a higher organis… |
| 1283 | Recall that a mutualism is beneficial to both organisms. Which of these accurately describes the met… |
| 1284 | What statement is false regarding the nitrogen cycle?… |
| 1286 | Which of the following accurately describes the way in which cellulosome enzymes break down cellulos… |
| 1287 | Ecology is heavily influenced by physiology and microbial communities. For example, Cellulose, chiti… |
| 1288 | An aggregation of Myxobacteria are exposed to low temperatures, dry conditions, and limited nutrient… |
| 1289 | You are working in a hospital lab analyzing different organisms commonly seen with diseases. You ar… |
| 1290 | Which technique(s) is(are) not useful once you ave located ORFs in a given DNA sequence?… |
| 1291 | Which of the following uses a screen to find a desired strain AND has the correct method of action u… |
| 1293 | A researcher has treated <em>E. coli</em> cells in order to insert a plasmid containing an ampicilli… |
| 1294 | Which of the followings statements of rhodopsin and photosynthesis are true. I. Both rhodopsin and … |
| 1295 | Which of the following IS true regarding microbial growth behavior in certain conditions?… |
| 1297 | Knowing that acid mine are highly acidic, which of the flowing chemolithoautotrophs would NOT contri… |
| 1298 | A major difference between a plasmid and a chromosome is:… |
| 1299 | Which of these is the incorrect match between a microbial element and its use within the microbe… |
| 1301 | Cyanobacteria is one of the major primary producer in lake environment. Its carbon source is CO<sub>… |
| 1302 | Billy needs to sterilize a scalpel for surgery, what method should he use to achieve this?… |
| 1303 | Cyanobacteria are MOST likely to be found in:… |
| 1305 | which carbon molecule below is the most effective for a cell to produce ATP?… |
| 1307 | A major difference in soil and lake environments is… |
| 1308 | Which of the following symbiotic relationships demonstrate the reciprocal nature between a methylotr… |
| 1309 | What would happen if you raised the temperature a few degrees higher than what a microbe can withsta… |
| 1311 | During nitrification, __________ perform the first step of the process by converting _________.… |
| 1312 | Which of the following is NOT part of nitrogen fixation?… |
| 1313 | Fungi use a lignin peroxidase that generates free radicals and breaks apart lignin instead of a lign… |
| 1316 | If a mutation occurs so that the LuxR gene is unable to bind to the auto-inducer, how would this eff… |
| 1317 | An environmental scientist is interested in analyzing the properties of an unknown island. When he i… |
| 1318 | What do lake, ocean, and soil environments have in common?… |
| 1319 | Which of the following is incorrect about CRISPRs safety?… |
| 1320 | Which of the following is NOT a reason why chemoheteroorganotrophs can live in the deep sea?… |
| 1321 | There is an allosteric Protein A, that is currently unbound to any substrate. When B binds to the pr… |
| 1324 | You are studying a novel microorganism that uses hydrogen sulfide as an electron source, carbon diox… |
| 1325 | The gene for the protein buckyase is controlled by an allosteric repressor protein (negative regulat… |
| 1327 | Which of the following processes could not be responsible for rising nitrogen levels in a lake?… |
| 1328 | Which of the following microbes would a farmer NOT want to be found in their fertilizer?… |
| 1329 | You collect a soil sample, and you want to see if it contains a target microorganism, <i>Streptomyce… |
| 1330 | You are a researcher at the University and are sent out to collect bacteria from a wastewater treatm… |
| 1331 | If the amount of phosphorous and/or nitrogen get too high in a lake, this can cause a cyanobacteria … |
| 1332 | What do primary producers at a deep sea ocean vent that grow by chemosynthesis have in common with p… |
| 1336 | Microbes impact the medical field through the use of vaccines. Which of these vaccination milestones… |
| 1337 | What is the main reason that bacteria can complete transcription and translation simultaneously?… |
| 1338 | Which of the following sequence differences in the 16S rRNA would most likely be present between mem… |
| 1339 | Which of the following statements is INCORRECT regarding the 16S rRNA?… |
| 1340 | Which is used as the hereditary material and why?… |
| 1341 | During which stage do enveloped viruses obtain their membrane?… |
| 1342 | Which protein related to replication is found in λ, but not found in Qβ and T4?… |
| 1343 | What is the difference between the composition of the capsid of an enveloped virus compared to the e… |
| 1344 | The two strands in a DNA double helix get their specificity and thermal stability from… |
| 1345 | Which of the following steps is not included when Gram staining bacteria in order to differentiate t… |
| 1346 | Of the following rRNA sequences from fictional organisms which sequence is most related to sequence … |
| 1347 | Which microscope would work best for observing stained Gram-positive bacteria?… |
| 1348 | When watching a micro-organism under a high-resolution microscope, the micro-organism is moving in a… |
| 1349 | Which type of bacterial cell (Gram-Positive or Gram-Negative) has a higher success rate in dry envir… |
| 1350 | Which of the following is not a difference between DNA and RNA?… |
| 1351 | Which bests describes the function of the Neuraminidase enzyme in viruses?… |
| 1352 | Provide a reason why DNA is largely used to carry hereditary information instead of RNA.… |
| 1353 | Which of the following happens after a virus begins to replicate its genome and viral proteins are e… |
| 1354 | Pick the correct pairing describing the run and tumble movement of bacteria who are motile by flagel… |
| 1356 | 16s rRNA sequencing is often used to construct a phylogenic tree. Below, scientists have isolated se… |
| 1358 | The double helical structure of DNA is stabilized by _______ between opposite bases and _______ betw… |
| 1359 | A leaf of a tomato plant has a stoma that is 7.5 micrometers wide. Which of the following microorgan… |
| 1360 | Which of the following rankings below about the relative size of microscopic beings, is correct?… |
| 1361 | Which of the following is a possible limitation of the DNA hybridization method of defining Archaea … |
| 1362 | You’ve discovered a new bacterium and you want to observe its chemotactic behavior. What staining an… |
| 1363 | Thonis Philipszoon was the first person to observe microorganisms (17th century). However, if it was… |
| 1364 | You have recently isolated two bacteria and found that they have 70% DNA-DNA hybridization; can the … |
| 1365 | What is the main difference between DNA and RNA according to their pentose sugar structure?… |
| 1367 | Which of the following structures could <b>not</b> be used for motility… |
| 1368 | Louis Pasteur was a pioneer in the field of microbiology, which of the following discoveries was he … |
| 1369 | Which of the following statements is true?… |
| 1371 | 5’ AUCCACGUACAGAUGGCACUGUUAUGAUGUCAAGACUUCCUG 3’ You translate the above mRNA sequence. How many … |
| 1372 | Which is NOT a function of the nucleus in Eukaryotes… |
| 1373 | The key difference between viruses and prions is that viruses… |
| 1381 | In the sequence 5' UUGUUGUUG... 3' repeating, how many different Amino Acids can be translated? UUG… |
| 1382 | What attribute of the DNA double helix allows it to be a stabile structure?… |
| 1383 | Which of the following is a problem when defining bacterial and archael species as having more than … |
| 1384 | Which of the following organisms is most closely related based on their 16S rRNA sequence? Organism… |
| 1385 | Below is the sequence of the template strand of a piece of a gene in some DNA. What would the antic… |
| 1387 | Bacteria are unique from Archaea and Eukarya in they ____ and they have membranes lipids that contai… |
| 1390 | You recently discovered a new virus that primarily infects UW-Madison students. Based on the knowled… |
| 1391 | In order to maintain a ____ surface to volume ratio and a ____ rate of diffusion, most Bacteria are … |
| 1392 | Which statement about viruses is false?… |
| 1393 | What makes DNA stable?… |
| 1394 | What is a biological impact of microbes?… |
| 1395 | What do λ and T4 viruses NOT have in common… |
| 1397 | What does a Gram-negative bacterium have in its cell wall that Gram-positive bacterium does not?… |
| 1399 | What is the correct order of the steps involved in transcription?… |
| 1400 | What two structures of Gram-negative cells and what two structures of Gram-positive cells (respectfu… |
| 1401 | Chemotaxis involves a _______ movement which is driven by _______.… |
| 1402 | A piece of viral genetic information enters into a eukaryotic host cell and migrates to the nucleus.… |
| 1403 | What is a possible limitation of the DNA hybridization method of defining Archaeal and Bacterial spe… |
| 1405 | You are planning an experiment in which you want to observe how a specific microorganism reacts to c… |
| 1407 | Which of the following is NOT true about the cell membrane and wall Gram-negative bacteria?… |
| 1408 | In general, microbes tend to be:… |
| 1411 | How would a point mutation (a change of a single base pair) in the termination sequence of a gene af… |
| 1414 | When people think of bacteria, they often equate it with negative attributes such as causing disease… |
| 1416 | You have two vials of subviral entities and are convinced that vial A contains prions and vial B con… |
| 1417 | 16S rRNA are used when comparing the evolutionary relationship between organisms as the sequence is … |
| 1419 | Polyhydroxybutyrate appears in the ______________ and is a way to store ______________… |
| 1420 | The key difference between viruses and prions is that viruses… |
| 1421 | Which of the following statements below is FALSE?… |
| 1422 | A bacterial cell is in a liquid medium while detecting an attractive chemical signal. It is in the o… |
| 1424 | A _____ symbolizes a(n)______ on a phylogenetic tree and means the organisms _______closely related… |
| 1425 | Your friend wants to engineer a new species and would like to know where the hereditary information … |
| 1426 | What makes prions different than viruses?… |
| 1427 | What are bacterial cell membranes made of?… |
| 1429 | Microbes are measured in _____________ and are able to be penetrated on the _____________.… |
| 1430 | Which structure can NOT be seen using a light microscope?… |
| 1431 | Choose which of the following statements is NOT true about the nucleoid.… |
| 1432 | When certain bacterial cells disintegrate, they leave behind components that can be lethal to mammal… |
| 1433 | Which of the following helps explain why glycolysis and the tricarboxylic (Krebs) cycle are so highl… |
| 1436 | Which of the following samples would you not be able to image well using a confocal microscope?… |
| 1437 | Which of the following is NOT a difference between prions and viruses… |
| 1438 | A student wants to view a translucent specimen to get an idea of its size and shape. They used a li… |
| 1439 | Given the following mRNA sequence, decode it into a 13 chain of amino acids using the codon table. … |
| 1440 | What was Edward Jenner's goal in his research involving milk maids?… |
| 1441 | The lack of 2'-OH group in the DNA double helix structure causes all of the following except...… |
| 1442 | What was the problem with traditional phylogenetic analysis when it came to bacteria and why was 16s… |
| 1443 | Given only the following 16S rRNA sequences, determine what organisms are the most and least related… |
| 1445 | Bob believes that the viral infection cycle is Attachment, Entry, Gene expression, Maturation, and R… |
| 1446 | What statement about DNA and RNA structure is true?… |
| 1447 | You are studying an amoeba and find a membrane protein of particular interest. Where would you likel… |
| 1448 | When viewing Gram stained bacteria under a bright-field microscope, you notice some bacteria are sta… |
| 1449 | You are studying a completely novel (new) microbe and observe it to have the following characteristi… |
| 1450 | A major difference between enveloped viruses and naked viruses is...… |
| 1451 | You have created a mutant of <i>E. coli</i> where the protein mutated is completely non-functional. … |
| 1452 | In an environment where a microbe must be smaller than 10 μm to evade protozoa attraction, which of … |
| 1455 | The chemical modification of a glucose molecule as it is transported across a cell membrane… |
| 1457 | What do T4, Qβ, and &lamda; viruses have in common ?… |
| 1458 | What is a difficulty that DNA viruses can face during replication and gene expression?… |
| 1459 | Which of the following is NOT true regarding the evolutionary relatedness of organisms based of phyl… |
| 1463 | The first step a lysogenic virus takes to infect a bacterium is attachment via specific recognition … |
| 1464 | What is a unique feature of Qβ that neither T4 or λ possess?… |
| 1465 | After viral nucleic acid has been replicated, transcribed and translated, what occurs next during vi… |
| 1466 | Which of the following statements about bacterial cell structure is not true?… |
| 1468 | Why must specimens be stained when using bright-field microscopy?… |
| 1471 | Which of the following is NOT a common trait between viruses and prions?… |
| 1473 | Why are microbes beneficial to basic research?… |
| 1474 | What is a major structural difference between unsaturated and saturated fatty acids that affects the… |
| 1476 | A difference between pili and flagella is that… |
| 1477 | When bacteria perform chemotaxis, they:… |
| 1479 | Which of the following statements about viral polymerase is true?… |
| 1480 | In which category of organisms can bacteria exchange DNA via horizontal gene transfer?… |
| 1482 | Which of the following statements regarding the structure of DNA and RNA is false?… |
| 1484 | Thonis Philipszoon (Antony Van Leeuwenhoek) was able to observe the first bacteria because… |
| 1485 | Which of the statements about microorganisms/microbes is/are true?… |
| 1489 | In bacteria, all transport systems are driven by:… |
| 1490 | When distinguishing between Gram-negative and Gram-positive bacteria, the difference between the two… |
| 1492 | Microorganisms have helped humans to discover all EXCEPT?… |
| 1493 | In prokaryotic cells, transcription and translation occur on the surface of the nucleoid and also… |
| 1494 | Working in a microbiology lab, your supervisor brings you a novel bacterium that needs to be classif… |
| 1495 | Which of the following statements is unique in Bacteria.… |
| 1500 | Which of the following is a main difference between group translocation and active transport?… |
| 1501 | When would a lysogenic virus like bacteriophage λ choose to enter the lytic phase immediately?… |
| 1502 | Which type(s) of viral genomic material do not have to bring a polymerase with them?… |
| 1503 | Which option correctly pairs the domain of life with a unique characteristic to that domain?… |
| 1504 | Microbes exist within both harmful and helpful relationships. Which of the following is/are a benefi… |
| 1505 | Every living organism contains an area specific for housing DNA. In which structure will you find th… |
| 1507 | In the process of a virus infecting a cell, the virus binds to the cell, invaginates, forms an endos… |
| 1508 | You find a small microbe in a stream during your field work. You know the shape but want to have a b… |
| 1509 | All the following are true about peptidoglycan except… |
| 1510 | This structural unit of prokaryotic cells is an irregularly shaped region that contains all of the g… |
| 1516 | Archaea are known for their ability to survive in extreme environments. What component of their cell… |
| 1517 | A feature that allows DNA to carry hereditary information rather than RNA is… |
| 1518 | A major difference between the cell membranes of bacteria, eukarya and archaea is that… |
| 1519 | Why was there a large lag between the work of Thonis Philipszoon and the cultivation and understandi… |
| 1520 | The DNA double helix is stabilized by all these forces except for...… |
| 1522 | In translation, which is the correct group of three stop codons that tell the cell when the polypept… |
| 1524 | What percentage of life on this planet is microbial (By biomass)… |
| 1525 | Tom Brock went on a trip to Yellowstone and saw something in the hot springs. This eventually led hi… |
| 1526 | One problem in origin of life research is to try to explain how a ribosome, which is mostly protein,… |
| 1527 | The protein MreB in bacteria… |
| 1528 | If the temperature of the environment that a bacterium is in drops, the membrane becomes… |
| 1529 | Which of the following bacteria would be most susceptible to lysozyme or penicillin?… |
| 1531 | Which of the following correctly lists the correct location of the periplasmic space?… |
| 1533 | You are a new researcher in a microbiology lab. You are working on an experiment to characterize an… |
| 1534 | Bacteria, Archaea, and Eukaryotes are the three main domains of the phylogenetic tree. Choose the be… |
| 1535 | If you consider all types of viruses (dsDNA, dsRNA, ssDNA, ssRNA) what structure/enzyme is required … |
| 1536 | Which type(s) of RNA have a secondary structure?… |
| 1539 | Which is NOT a way that bacteria impact our daily lives?… |
| 1542 | Is DNA or RNA a better host for hereditary information? Why?… |
| 1543 | An infected cell culture is exposed to ultraviolet radiation in hopes of neutralizing any unwanted v… |
| 1544 | Which of the following is a possible outcome of a Lambda phage infecting a cell?… |
| 1547 | Which of the statements below regarding chemotaxis is false?… |
| 1548 | Which of the following is true about phylogenetic trees?… |
| 1549 | Which of the following is false about the role of the promoter in transcription?… |
| 1552 | What piece of evidence below supports the Endosymbiosis hypothesis?… |
| 1554 | Why does saliva act as a defense mechanism against bacterial invaders but doesn’t damage the h… |
| 1555 | Bacteria, Eukarya, and Archaea have in common these components <b>except</b>… |
| 1556 | The following four strands of 16 rRNA sequence were identified from four separate species. Which two… |
| 1557 | You have a microbe, <i> Moorella</i> strain AMP, that can grow on formate by converting it to hydrog… |
| 1558 | Your colleague is investigating an anaerobic ocean environment where the sulfate is disappearing and… |
| 1559 | In the mechanism of ATP synthase, the beta subunits… |
| 1560 | Take a look at this metabolic pathway. In the final step, the conversion of acetyl-P to acetate is a… |
| 1561 | This pathway shown below is an example of.... <img src="/instr/images/quickcheck/bifido.png" alt="A… |
| 1562 | Kombucha tea is fermentation of the sugar added to tea by yeast, acetic acid bacteria, and lactic ac… |
| 1563 | Which of the following is true for aerobic respiration but not for anaerobic respiration?… |
| 1564 | Your bright, overly energetic, graduate student comes to you with a plan to increase the growth of a… |
| 1565 | Looking at the growth rate of <i>L. lactis</i> under aerobic and anaerobic conditions, it appears th… |
| 1566 | ATP synthase generates ATP through the proton motive force. As ATP synthase turns, protons fall thro… |
| 1567 | A medium is prepared that contains the following ingredients: <table class="table table-striped"> <… |
| 1568 | Below are statements about anaerobic respiration and aerobic respiration, which one or ones is FALSE… |
| 1569 | Which of the following pathways contain a redox reaction?… |
| 1570 | There are two main differences between oxygenic and anoxygenic photophosphorylation, what are they?… |
| 1571 | Which of the following are reasons that microbes may have limited growth in an environment?… |
| 1572 | The type of metabolic pathway that will produce the maximum yield of ATP will be:… |
| 1573 | Microbes ferment many foods for human consumption such as cheese, chocolate, and beer. One way to re… |
| 1574 | An isolated mesophilic organism is being cultured in the Microbiology lab at 50°C on a Nutrient … |
| 1575 | Which of the following does not increase reaction rate?… |
| 1576 | A researcher is considering using the optical density (OD) method for monitoring the growth rate of … |
| 1577 | Which of the following statements about iron-sulfur proteins is true?… |
| 1578 | Which of the following is true regarding irradiation methods to control microbial growth?… |
| 1579 | In the reaction A+B-->C+D, if the concentration of D increases, in what direction will the reaction … |
| 1580 | You are attempting to grow some of the bacteria you find in your room and measure its growth. But di… |
| 1581 | Bucky wants to enrich his soil sample for <i>Streptomyces</i>. He sterilized the tools that he would… |
| 1582 | Why does cooking food minimize microbial growth and keep it from spoiling as fast as it would if it … |
| 1583 | All of the following contribute towards the generation of a proton gradient EXCEPT:… |
| 1584 | Which of the follow statements about nutrients is FALSE?… |
| 1585 | How does light create a proton gradient in retinal-based phototrophy reactions?… |
| 1586 | A friend isolated a new bacterium and wants to know if it uses fermentation as its sole source of ge… |
| 1587 | Which of the following contain Bacteriochlorophyll as a photo pigment in their light harvesting stuc… |
| 1589 | Using the table of electron half reactions, which of the following flow of electrons is correct? <i… |
| 1590 | Which of the following are true concerning the difference between substrate-level phosphorylation an… |
| 1591 | Which statement regarding fermentation is false?… |
| 1592 | How does aerobic respiration differ from anaerobic respiration?… |
| 1593 | I am trying to make a food product that contains only lactate as the end product, which type of ferm… |
| 1594 | A brewer makes a wört that is high in sugar, however, he has a leak in his fermentation vessel … |
| 1595 | Which of the following statements is false regarding oxygenic and anoxygenic photosynthesis?… |
| 1597 | You are making cheese at WeSaySo Dairy Corporation. The milk is pasteurized and starter culture is a… |
| 1598 | The chlorosome found in green bacteria is analogous to… |
| 1599 | If you compare the reaction centers of green, purple, and cyanobacteria, they all have… |
| 1600 | Unknown to you, you have purchased meat contaminated with <i>Salmonella enterica</i>. However, you c… |
| 1601 | Bacteria that are living in a biofilm have the advantage of ________________ but the disadvantage of… |
| 1602 | An electrochemical gradient is required in which of the following processes:… |
| 1603 | The macronutrients found in all living cells are:… |
| 1606 | Fermentation of kimchee is a 3-step process. What would happen if the third step failed to occur?… |
| 1607 | Which of these electron acceptors are NOT used in anaerobic respiration?… |
| 1609 | A microbe was growing spectacularly in its environment, but suddenly this growth seems to have come … |
| 1610 | Given these two half-reactions, determine which has the most potential energy?<br /> <img alt="The … |
| 1612 | Which of these is NOT involved in oxidative phosphorylation?… |
| 1613 | A new bacterium is found and it was discovered that it gets its energy from oxidation of organic com… |
| 1614 | Organisms with very specific nutritional needs and growth factor requirements are often called fasti… |
| 1615 | Which of the following is a key spore structure providing it with resistance to radiation?… |
| 1616 | Organisms with very specific nutritional needs and growth factors are often called fastidious; and i… |
| 1617 | The shape of an organism (by the shape of its cell wall) is dictated by?… |
| 1618 | Which of the following is not a consequence of Binary Fission?… |
| 1620 | What would happen if you were to cut off the light source to a bacterium classified as a "chemoautot… |
| 1621 | Select the most correct statement when comparing retinal-based phototrophy to generic photosynthetic… |
| 1622 | You are doing another boring organic chemistry lab with a chemical reaction that is notorious for ta… |
| 1623 | A major difference of cell structure and function in biofilm versus planktonic cells is...… |
| 1625 | Which of these food preparation/preservation techniques would <b>not</b> minimize microbial growth d… |
| 1627 | Which method(s) is(are) best in controlling microbial growth in food?… |
| 1628 | Which of the following values would indicate an organism grows the slowest.… |
| 1629 | Which of the following statement is incorrect?… |
| 1630 | Which micronutrient stabilizes the ribosome and is needed for ATP-dependent reactions?… |
| 1632 | According to electron potential, which compound is most likely to be an electron donor at the beginn… |
| 1634 | Which of the following matches the essential element of all microbes with the correct function?… |
| 1636 | Which of the following catabolic pathways perform substrate level phosphorylation to synthesize ATP?… |
| 1639 | If you sterilized surgical equipment what kind of microbes would you expect to remain?… |
| 1640 | You wish to culture some <i>E. coli</i> overnight for an experiment you want to perform tomorrow. Yo… |
| 1641 | Which of the following about the flow of electrons in the respiratory chain are false?… |
| 1642 | A primary distinction between photosynthesis and retinal-based phototrophy is that photosynthesis de… |
| 1643 | You are observing an unknown microorganism that has been incubating at room temperature in thioglyco… |
| 1644 | It is discovered that a Gram-negative bacterium has a dysfunctional F<sub>o</sub> Motor Protein when… |
| 1647 | Which method of measuring cell number is ideal if you only want living cells?… |
| 1648 | What type of organism will be able to live an environment with a decreased amount of water (dry)?… |
| 1649 | You are running a very time-sensitive experiment that involves culturing a microbe with a growth rat… |
| 1651 | Given the reaction and a table of electron half reactions, why is this a favorable reaction? 2NADP<s… |
| 1652 | A bacterium has a respiratory pathway that uses iron as its electron donor and oxygen as its termina… |
| 1653 | You are in Micro 304 and must go out in nature to collect a sample for the nature isolate lab. In or… |
| 1654 | A researcher in the lab wants to find out whether there are aerobic nitrogen fixers present in a sam… |
| 1655 | A certain species of lactic acid bacteria is a chemotrophic aerotolerant anaerobe. It is cultured on… |
| 1656 | Glucose + ATP → Glucose-6-P + ADP In this reaction, if you increase amounts of Glucose-6-P and ADP,… |
| 1657 | Purple bacteria are...… |
| 1659 | Which of the following scenarios describes the growth of planktonic cells?… |
| 1661 | Endospore formation is triggered by limited nutrients amidst high cell density. Which of the followi… |
| 1662 | Below are the components of an electron transport chain that reduce iron for <em>Bucky wisconsinis</… |
| 1663 | When a yeast cell is given sugar in an aerobic environment, what will it do?… |
| 1664 | Which of the following best describes how ATP is generated in a photosynthetic bacterium?… |
| 1665 | You are growing a series of bacterial cultures for your lab when you notice a potential contaminant … |
| 1666 | Which type of fermentation produces more than one product?… |
| 1668 | What treatment allows for the extended shelf life of fresh shrimp?… |
| 1670 | Which of the following does not accurately describe a way to control microbial growth?… |
| 1672 | Water availability is an important factor for growth. <i>Halobacterium salinarum</i> has adapted to … |
| 1673 | If cytochrome <i>b/c1</i> were removed from the electron transport chain, the process would lose wha… |
| 1674 | Which is incorrect about pasteurization and sterilization?… |
| 1675 | Which of the following is/are characteristic of the Light Harvesting Complex (LH Complex) in Green … |
| 1676 | Which of the following steps must happen FIRST to pump protons across the membrane?… |
| 1678 | All microbes require all of the following for favorable growth except...… |
| 1680 | __________ directly phosphorylates ADP into ATP with phosphate and energy provided from a coupled re… |
| 1681 | What physical treatment would you use to sterilize a liquid that contains bacteria as well as small … |
| 1682 | A microorganism in a harsh environment is having a hard time making stable RNA and DNA despite havin… |
| 1683 | Which of the followings is true about substrate level phosphorylation?… |
| 1684 | What is the main difference between aerobic respiration and anaerobic respiration?… |
| 1685 | Which of the following is a true distinguishing factor regarding the light harvesting centers in pur… |
| 1686 | Temperature, being a limitation on growth, exists in many different ranges. What happens to microbes… |
| 1688 | After glycolysis, there is an excess amount of NADH. In homofermentation, which molecule does this N… |
| 1689 | Which of these is different between substrate level phosphorylation (SLP) and electron transport lev… |
| 1690 | Which of the following statements about purple bacteria is true.… |
| 1691 | You are trying to isolate cyanobacteria to better understand the problems that lake Mendota is facin… |
| 1692 | After running some tests on a newly discovered bacterium, you discover it uses light as an energy so… |
| 1693 | Which of the following elements is not needed at concentrations of less than 1%?… |
| 1696 | If a novel bacteriophage is discovered that effectively disables the reaction center in light depend… |
| 1698 | Which of the following choices is a reason why purple bacteria can be a great model systems for rese… |
| 1704 | Which of following statement about Chlorobiaceae, the green sulfur bacteria, is false?… |
| 1705 | The following statement on the differences and similarities between retinal-based phototrophy to cla… |
| 1707 | Which of the following undergo anoxygenic photosynthesis?… |
| 1708 | Which metabolic pathway(s) generate(s) ATP through substrate level phosphorylation?… |
| 1709 | You decide to start farming cocoa trees in Wisconsin (great idea), and you somehow get a successful … |
| 1711 | Which one of the following explanations best summarizes the relationship between carotenoids and chl… |
| 1712 | Which of the following statements regarding chemoheteroorganotrophs is false?… |
| 1713 | When comparing biofilm and planktonic cells, which of the following is true?… |
| 1715 | Which of the following is not a reason why purple bacteria is such a good model organism?… |
| 1716 | Dr. Paustian heats a solution containing microbes to a temperature that kills most but not all of th… |
| 1717 | You want a culture of <i>Bacillus subtilis</i> to reach a concentration of 1 x 10<sup>5</sup> by 3 P… |
| 1718 | Which of the following problems often encountered during the cheese making process is likely caused … |
| 1719 | What mechanism does ATP synthase use to create ATP?… |
| 1720 | Chlorophyll and carotenoids in the reaction center have all the following in common EXCEPT...… |
| 1722 | Which of the following would be the least likely to act as terminal electron acceptors in anaerobic … |
| 1725 | Which of the following is false about retinal based phototrophy?… |
| 1726 | You are studying how an obligately anaerobic bacterium will react under stressed conditions. Select … |
| 1727 | Fred Griffith's transformation study with rough and smooth cells in <i>Streptococcus pneumoniae</i> … |
| 1728 | In <i>E. coli</i> what happens if a mutation in symR antisense RNA cause it to not hybridize to SymE… |
| 1729 | In an attempt to mutagenize <i>Xanthobacter autotrophicus</i> a pRL27 plasmid was mated from <i>E. c… |
| 1732 | Which is an NOT option you may use to preform a screen to isolate or identify a mutant?… |
| 1733 | Oh no! You've accidentally exposed so E. coli to a mutagen that causes section 4 on the mRNA transcr… |
| 1734 | In quorum sensing in <em>Staphylococcus aureus</em>, there is a mutation in <em>agrC</em> so that it… |
| 1735 | In Griffith's classic experiment of rough and smooth cells, the following situation showed that DNA … |
| 1736 | You have a culture of bacteria and you want to find mutant cells that are resistant to an antibiotic… |
| 1737 | A lithotroph, such as those that oxidize iron, use which of the following as an electron source?… |
| 1738 | Which of the following is true of Griffith’s classic experiment with rough and smooth cells in mice?… |
| 1739 | You are attempting to grow a bacterial culture in the lab. You plate the culture on a minimal medium… |
| 1741 | Which of the following is NOT an important ecological/physiological function of soil microbes?… |
| 1743 | You are conducting a study in an ocean environment. What is an example of a microbe you might encoun… |
| 1744 | Which of the following is the most direct reason for fish kills after cyanobacterial blooms?… |
| 1745 | The <i>trp</i> operon utilizes repression, attenuation, and feedback inhibition. Which of the follo… |
| 1746 | You are analyzing the sequences of two bacteria that you collected from the same soil sample. They s… |
| 1747 | If an allosteric effector binds itself to a protein via an allosteric site, what will happen?… |
| 1748 | You collect a soil sample, extract DNA, and sequence it. After using an assembler you find a 200 kil… |
| 1749 | Consider all the regulatory circuits that control the <i>trp</i> operon when answering this question… |
| 1751 | In <i>E. coli</i> you have isolated a mutant CAP (also known as CRP) gene that behaves as if cAMP is… |
| 1752 | A <i>Vibrio fischeri</i> strain having a mutation in LuxR such that it no longer can bind AHL (acyl-… |
| 1753 | It is possible to accurately predict if a bacterium has sections of its DNA from another bacterium (… |
| 1754 | Sorcerer II yielded data on an unidentified organism. The organisms genome contains an ORF for a pro… |
| 1756 | What is true about catabolic operon and anabolic operon?… |
| 1758 | Which of the following statements are true for plasmids in microbes?… |
| 1759 | Which of the following sequence of events correctly describes a CRISPR-Cas mechanism?… |
| 1762 | There were TT dimers observed in a patient's DNA strands. It is also fixed by photoreactivation. Wha… |
| 1763 | When sequencing the genome of a microbe isolated from the environment, you notice that the microbe c… |
| 1764 | You grow ten separate cultures of <i>E. coli</i> overnight. Each of these is plated onto ten plates … |
| 1765 | You isolate a new organism from the turf of Camp Randall, <i>Bucky badgerous</i> and sequence its en… |
| 1766 | You take the bacterium <i>Bucky badgerous</i> and use CRISPR to knock out xylose catabolism by inser… |
| 1767 | Which of the following is not a step in CRISPR gene editing?… |
| 1768 | What function does CRISPR serve in bacteria?… |
| 1769 | In the Ocean at a depth of 150 meters, select the best option to describe the microbe that lives the… |
| 1770 | Working in your universities microbiology lab you are asked to identify a microbial species for your… |
| 1771 | Which of the following organisms would be expected to be a primary producer around a deep sea ocean … |
| 1772 | If a mutation formed in a strain of <i>E. coli</i> that resulted in complete inactivation of the cat… |
| 1774 | You are observing a community of microbes in anaerobic conditions. You observe a large amount of ace… |
| 1775 | You take a sample from a lake and discover an Actinobacteria that is producing ATP using ATP synthas… |
| 1776 | You cause a mutation to a <i>Vibrio fischeri</i> which deactivates their Luxl activity. A phenotypic… |
| 1777 | CRISPR could be a novel new technology in the world of Human Immunodeficiency Virus because it…… |
| 1778 | What is false about the symbiosis between the tube worm and sulfur oxidizing bacteria?… |
| 1779 | Which of the following is true of actinorhodopsin found in acI actinobacteria?… |
| 1781 | The scaffolding of cellulose enzymes serves what purpose when degrading cellulose?… |
| 1782 | Suppose you have used CRISPR to mutate a microbe to relieve catabolic repression and allow a bacteri… |
| 1785 | <i>Vibrio fischeri</i> use autoinduction and quorum sensing in order to produce bio-luminescence. Wh… |
| 1786 | After a long hard winter in Wisconsin, Fred, a timber rattlesnake, assesses his DNA. He finds a erra… |
| 1789 | Why would a fungus break down wood with free radicals instead of enzymes on the cell surface like th… |
| 1790 | A mutation occurs within the allosteric site of the repressor that binds to the tryptophan operon, t… |
| 1791 | The recently discovered wiscose operon (wisc) produces catabolic genes that degrade wiscose and has … |
| 1793 | Which of the following points of regulation is paired correctly with its mechanism?… |
| 1794 | Bacteriorhodopsin provides a huge advantage for Archaea under:… |
| 1795 | Which of these microbes lives in the ocean, is a thermophile, and uses Fe<sup>3+</sup> as the termin… |
| 1796 | You are given a large amount of <i>Nitrobacter winogradskyi</i> which is a nitrite-oxidizing bacteri… |
| 1797 | Griffith used two related strains of <i>Streptococcus pnuemoniae</i>, R and S. When grown....… |
| 1801 | You are maintaining a culture in the laboratory that is able to grow on minimal medium containing ma… |
| 1802 | A severe mutation causes a strand of anti-sense RNA to be unable to bind to its complementary mRNA t… |
| 1808 | Which of the following about cellulose degradation by cellulosomes is false?… |
| 1809 | What are the phenotypic consequences of a frameshift mutation in <i>lacZ</i>?… |
| 1810 | You've isolated a novel bacterial strain and want to understand the makeup of its genome. One me… |
| 1811 | Which of the following reasonings are TRUE regarding cyanobacteria growth?… |
| 1812 | In a laboratory, you have a sample of <i>Nitrosomonas europea</i> which is an ammonia-oxidizing bact… |
| 1813 | What would be the result of a mutation in adenylate cyclase that rendered it completely unfunctional… |
| 1815 | Which of the follow is correct regarding primary producers of lakes and deep sea vents?… |
| 1816 | Which one of these is NOT a benefit of CRISPR?… |
| 1817 | Which of the following statements is <strong>incorrect</strong> about CAS gene functions?… |
| 1818 | You expose a strain to a transposon containing bacitracin resistance. Then you plate the resulting c… |
| 1819 | You accidentally exposed a culture of bacteria to UV light causing mutations in the DNA. What method… |
| 1820 | You suspect a mutation in the lac operon of <i>E. coli</i>, causing it to no longer ferment lactose.… |
| 1821 | Cyanobacteria usually increase in growth during the Spring because...… |
| 1826 | A major difference between plasmids and chromosomes is that… |
| 1827 | The Hawaiian bobtail squid hides its shadow through a _________ relationship with <i>Vibrio fischeri… |
| 1828 | You’re a scientist working with a new bacteria, <i>Buckii badgeris</i> that has no plasmids. Trying … |
| 1830 | While examining a strand of DNA you stumble upon a dimer between two thymine bases. What do you susp… |
| 1831 | If there is a mutation in region 4 so that it can no longer hybridize with region 3 of the <i>trp</i… |
| 1833 | Which of the following is/are true regarding bacteriochlorophyll and rhodopsin?… |
| 1834 | Anthranilate synthase is a key enzyme in the tryptophan synthesis pathway. Which of the following co… |
| 1835 | All of the following are sites of bacterial gene expression EXCEPT:… |
| 1836 | A functional difference between a catabolic operon and an anabolic operon is that… |
| 1839 | If there were to be a spontaneous mutation in the allosteric site of CAP *(also known as CRP) that i… |
| 1843 | It is rare to find mutations in SymR (the antisense RNA that regulates SymE). Why do you think that … |
| 1845 | A mutation in DnaK such that it can no longer bind to RpoH (aka σ-32) would result in… |
| 1846 | UV light is known to cause pyrimidine dimer mutations within DNA, which is why tanning too much can … |
| 1847 | A drug resistance gene transfers from <i>Bacillus cereus</i> to <i>Steptococcus pneumoniae</i>. This… |
| 1852 | If there were a mutation in AgrD of <i>S. aureus</i>, such that it does not bind to AgrB, what would… |
| 1854 | Which statement is true regarding Fe oxidation in iron-oxidizing microbes and oxidative phosphorylat… |
| 1855 | Which is of following are conditions or tests that can be used when selecting to find a desired stra… |
| 1856 | <i>Leptospirillum ferrooxidans</i> is the dominant bacterium in the acid mines. It grows by oxidizin… |
| 1857 | What of the following properties is true for oligotrophic lakes in comparison to eutrophic lakes?… |
| 1859 | When thinking of the role of Cyanobacteria in the lakes (<i>Anabaena</i> sp.) and ocean (<i>Prochlor… |
| 1860 | Regarding the carbon cycle, which of the following is true?… |
| 1861 | If a spontaneous mutation arose in the Cas9 that inactivate the protein, what would be the result fo… |
| 1862 | After a long drought, you examine the soil and want to determine whether or not there are any viable… |
| 1863 | All of the following are potential risks of CRISPR except?… |
| 1864 | Which of the following is true about the process by which photoautotrophs fix carbon.… |
| 1865 | Which of the followings is more likely to cause a thymine dimer mutation?… |
| 1866 | Ac1 is a type of actinobacteria found in lakes that uses actinorhodopsin to:… |
| 1867 | A mutagen causes part of a genome to undergo a base change, where a cytosine is deaminated leaving u… |
| 1868 | Given the major differences between methanotrophs and autotrophs, what is a distinguishing feature t… |
| 1870 | Which of the following microbe types would most likely be dominant in an anaerobic, sulfate free env… |
| 1871 | Bacterial species such as <i>Flavobacteria</i> increase in number after a Cyanobacteria bloom to deg… |
| 1876 | What would be the phenotypic consequence if the AgrC (the protein that binds AIP) in <i>Staphylococc… |
| 1878 | Which of the following statements is false when comparing Fe oxidation and oxidative phosphorylation… |
| 1879 | How are plasmids are chromosomes different in bacterial cells?… |
| 1880 | You've been given the task of altering the DNA sequence of a novel bacteria using CRISPR. What is th… |
| 1881 | Researchers have noticed an unusual number of dead fish in Lake Mendota. They test a sample of the l… |
| 1882 | The essential difference between a plasmid and a chromosome is:… |
| 1883 | Plasmids maintain themselves in their host cell by all of the following except...… |
| 1884 | A mutation occurs within the <i>luxI</i> gene of <i>Vibrio fischeri</i>, causing it to no longer fun… |
| 1885 | Which of the following species does NOT benefit from a symbiont microbe species that uses N<i>2</i> … |
| 1886 | <i>Methylomirabilis oxyfera</i>, a bacterium that uses N-DAMO, uses _____ as an energy source and ge… |
| 1888 | Which organism does Cyanobacteria have a nitrogen-fixing partnership with.… |
| 1890 | There is a strain of <i>Corynebacterium diphtheriae</i> that seems to be resistant to a multitude of… |
| 1892 | One wants to minimize the production of lactose and maximize the production of tryptophan, what is t… |
| 1893 | Quorum sensing is advantageous in bacterial cells in all the following ways except...… |
| 1894 | Low copy number plasmids rely on the host cell for the following functions...… |
| 1895 | Which of the following is/are true about the components of a plasmid… |
| 1896 | Which of the following explanations is correct regarding this statement: Brown rot fungi use lignin … |
| 1897 | Different species of microbes can share portions of their genomes as well as different individuals w… |
| 1898 | During which step of the nitrogen cycle will a facultative anaerobe grow on oxygen if it is availabl… |
| 1899 | Which of the following statements regarding Griffith's classic experiment is false?… |
| 1900 | You examine a dead deep sea tube worm and determine it died from not having enough organic carbon. W… |
| 1902 | Which of the following may contribute to the virulence of a pathogen?… |
| 1903 | Which of these would tell you if a microbe has experienced Horizontal Gene Transfer just by using a … |
| 1905 | What would happen to a tube worm if it encountered cyanide ( a respiratory poison)?… |
| 1907 | Which of the following is not a primary producer at a deep sea ocean vent?… |
| 1910 | An E.coli cell is infected by a bacteriophage. The bacterium has CRISPR guide RNA that is able match… |
| 1911 | Which of the following is false regarding horizontal gene transfer?… |
| 1913 | Which of the following is incorrect regarding rhodopsin and photosynthesis.… |
| 1914 | A mutation in the <i>trp</i> operon that causes a deletion of the <i>trpE</i> gene would…… |
| 1915 | A strain of <i>E. coli</i> has a deletion mutation of <i>malT</i>. If you place the strain in a Rich… |
| 1916 | You have found a repressor protein (<i>leuR</i>) that prevents synthesis of leucine in <i>Bucky anon… |
| 1917 | Which of the following is not often found on plasmids?… |
| 1918 | Which of these microbes involved in the carbon cycle would use methane as a substrate under anaerobi… |
| 1919 | You are looking for mutants that are no longer able to synthesize isoleucine. A culture is mutageniz… |
| 1920 | Which of the following statements is correct regarding choline and cardiovascular disease (CVD)?… |
| 1921 | What is the main reason that vegans fed a steak meal do not have the same TMAO response compared to … |
| 1923 | These cells are a part of the adaptive immune system. They produce antibodies that antigens react wi… |
| 1924 | The following cell type does not match the description of its function in the body… |
| 1925 | All of the following are true regarding <i>Borrelia burgdorferi</i>, a bacterium that causes Lyme's … |
| 1926 | Which of the following is false about virulence and virulence factors?… |
| 1928 | What is the function of type III secretion systems in <i>E. coli</i>?… |
| 1930 | An example of a toxin that causes in an over reaction of the immune system is:… |
| 1931 | Suppose a hypothetical medication is being tested for FDA approval. During clinical trials, the medi… |
| 1932 | HIV and HPV are similar in that… |
| 1933 | Which of the following statement is incorrect?… |
| 1934 | Which of the following is false about the inflammation response?… |
| 1936 | Which is a strategy pathogens are known to use to survive inside a phagocyte?… |
| 1939 | How do cytotoxic T-cells recognize infected cells in order to kill them?… |
| 1942 | Which of the following are reactions leading to the killing of a target cell/pathogen can be mediate… |
| 1943 | It has been found that mice with an excess of flavonoid-degrading microbes will:… |
| 1944 | When considering acetogens and methanogens, one thing they have in common is...… |
| 1945 | Methanogens are often at higher concentrations than sulfate reducers in freshwater sediments, while … |
| 1946 | The human microbiota helps humans by… |
| 1947 | Which statement regarding Human papillomavirus is false?… |
| 1950 | What is the best way to treat a severe, but not yet life-threatening case of <i>Clostridium difficil… |
| 1951 | Skunks can harbor Leptospira bacteria without showing symptoms of the disease and transmit it to hum… |
| 1952 | Which of the following are <b>not</b> ways in which complement kill microbes?… |
| 1953 | When considering the oral microbiome, which of the following statements is true.… |
| 1954 | A sulfate reducer could form a syntrophic relationship with a purple photosynthetic bacterium that c… |
| 1955 | It's the year 2025. A new probiotic firm claims to have formulated a microbiome that if you take it… |
| 1956 | Immature T-cells have the potential to react with self-antigens. What of the following mechanisms th… |
| 1960 | Given what you know about <i>E. coli</i> and its mode of transmission, how would you reduce its' spr… |
| 1961 | After a period of rapid weight loss, which is true?… |
| 1962 | The oral microbiota… |
| 1963 | Which of the following is true about microbiota in the oral cavity?… |
| 1964 | Which statement is false regarding the role of <i>Akkermansia muciniphila</i> in the GI tract?… |
| 1965 | Which one of the following body systems are not involved in the immune response?… |
| 1966 | Recent research has shown that vegetarians have a one-third lower risk of heart disease than those w… |
| 1967 | Phagocytes have oxygen-dependent and oxygen-independent mechanisms to kill engulfed microbes. Which … |
| 1968 | Which of the following immune processes is not involved in detecting the presence of a pathogen.… |
| 1969 | Hemorrhagic <i>E. coli</i> is found in dairy and beef cattle. They cannot contract the disease. Ther… |
| 1970 | Shiga toxin works by… |
| 1971 | Which is not a virulence factor of <em>Staphylococcus aureus</em>?… |
| 1973 | The Gram-positive pathogen <i>Clostridium difficile</i>… |
| 1974 | Would a fecal transplant of the microbiome of a thin individual into an obese individual help them l… |
| 1975 | Which is true about monocytes and neutrophils?… |
| 1977 | Which correctly matches the shape of the epidemic and its source?… |
| 1978 | Which of the following best explains how the complement system is activated… |
| 1979 | This virus replicates by having its (+) strand RNA translated into a polyprotein that is then degrad… |
| 1980 | Exotoxins have an A:B structure. The B subunit(s) __________, while the A subunit contains the _____… |
| 1981 | A characteristic of <i>Borrelia burgdorferi</i> that makes the microbe particularly difficult to dia… |
| 1982 | C. difficile is commonly acquired… |
| 1983 | A thin moose is seen, isolated from its herd, drinking from a stream in your backyard. Assuming that… |
| 1984 | Lyme disease is unique as it uses a microbe that can_____ which is important in its_____… |
| 1985 | WHich of the following is not true for <i>Clostridium difficle</i>?… |
| 1987 | Which of the following would be the most effective quarantine protocol?… |
| 1988 | What is the primary reason we do not commonly see malaria outbreaks in the United States?… |
| 1989 | You've just come home from your best friend Tim's holiday dinner party when you start to feel a litt… |
| 1990 | What is the KEY difference between exotoxins and endotoxins?… |
| 1992 | Which of the following distinguishes influenza’s replication from that of the HIV virus (human immun… |
| 1993 | Neurotoxins are an example of _____ , many of which are proteins that are normally _____ by pathogen… |
| 1995 | How does the influenza virus copy its genome and disguise it as mRNA for translation in a host cell?… |
| 1997 | A boy named Zack is infected with a pathogenic strain of Bucus badgeritis. The bacteria have made it… |
| 1998 | How does human papillomavirus cause cancer?… |
| 1999 | What are ways pathogens evade defenses of the Innate Immune System?… |
| 2000 | Leukocidin is:… |
| 2001 | Which of the following is NOT a way that pathogens are directly transmitted from person-to-person?… |
| 2002 | Which of the following are cells/receptors involved in HIV pathogenesis? I. CD4 receptor II. CD4 e… |
| 2003 | Which of the following is NOT a method of disease transmission from human to human… |
| 2004 | _________ is an exotoxin that causes damage by _________.… |
| 2005 | Lethality of endotoxins is due to… |
| 2006 | Where do phagocytes originate?… |
| 2008 | Which of the following statements regarding the presence of <i>Akkermansia muciniphila</i> in the an… |
| 2009 | Invading cells "hide" from the immune system by...… |
| 2010 | Which of the following is FALSE regarding human papillomavirus (HPV)?… |
| 2016 | The main job of phagocytes in the human body is to… |
| 2018 | Which of the following is true regarding the AB Shiga toxin of Enterohemorrhagic <i>E. coli</i>?… |
| 2020 | Which of the following cell types do NOT have MHC II molecules (are NOT antigen presenting cells)?… |
| 2023 | Which of the following is NOT a way in which the body is able to recognize and/or respond to a patho… |
| 2025 | According to the Gleam experiment (an infection simulation modeler), how is the spread of a disease … |
| 2026 | True or False: Using a GLEAM simulation map, completely restricting travel of patients showing sympt… |
| 2028 | Why does only limiting travel for symptomatic people have a negligible effect on disease spread?… |
| 2031 | Complications resulting from an EHEC infection (Hemolytic Uremic Syndrome - HUS) can cause… |
| 2033 | You got ill from eating at your favorite restaurant. How do you suspect the pathogen causing your sy… |
| 2034 | A new microbe, <i>Howardicia sternius</i>, is responsible for a recently discovered disease. Assumin… |
| 2035 | Which type of toxin is in the outer membrane of the cell wall and is usually only a problem when the… |
| 2036 | Which of the following is not one of the ways that the body detects the presence of a foreign antige… |
| 2037 | When observing a Gleam Map, how does Quarantine affect the spread of an infectious disease?… |
| 2038 | What is a difference between a neutrophil and monocyte?… |
| 2039 | Which of the following statements is false regarding pathogens?… |
| 2040 | Which of the following steps of disease often lead to transmission to a new host?… |
| 2041 | How is the metabolic role of microbes for humans similar to the metabolic role of microbes for rumin… |
| 2042 | Stopping all travel will do what to an epidemic?… |
| 2046 | Which of the following statements about Malaria is true?… |
| 2047 | In malaria… |
| 2048 | Which of the followings about endotoxin and exotoxin is true?… |
| 2049 | Which of the following situations would NOT be satisfied by Koch's postulates?… |
| 2050 | When considering phagocytes...… |
| 2051 | HIV infections can be treated with… |
| 2052 | Preventing the spread of <i>Clostridium difficile</i> can best be achieved by… |
| 2053 | The HPV can be mitigated by… |
| 2054 | <i>Borrelia burgdorferi</i> is… |
| 2055 | Consider HIV, Rhinovirus, HPV, and Influenza virus, HIV is unique in that.… |
| 2056 | β-lactam antibotics inihibit______________, fluoroquinolones stop __________________, and macrolide … |
| 2057 | Vaccines that are in use today to prevent infection are… |
| 2058 | We are seeing a rise in vaccine-preventable diseases because… |
| 2059 | What best describes the Staphylococcus food poisoning life cycle?… |
| 2060 | Which of the following is considered an exotoxin?… |
| 2062 | Which is <strong>not</strong> an example of mutualistic symbiosis between host and microbiota?… |
| 2063 | Which of the following is NOT true regarding the Chlamydia life cycle?… |
| 2064 | You just started your position at a microbiology lab focusing on the human microbiome. You are helpi… |
| 2065 | A student was admitted into the hospital for an unknown illness. The student experienced fever, abdo… |
| 2067 | In mice fed labeled dietary choline, labeled TMAO… |
| 2069 | A patient receives a kidney transplant after experiencing renal failure. This individual is released… |
| 2070 | Which of the following statements is false when defining a disease?… |
| 2071 | Which of these macromolecules would be the weakest antigen?… |
| 2072 | Which of the following regarding inflammation is FALSE?… |
| 2073 | Which of these is NOT an example of a virulence factor?… |
| 2074 | HPV is a virus that causes cancer in humans. Why does HPV cause cancer and many other viruses, such … |
| 2075 | If a person suddenly faced a loss of their microbiota inside and outside of their body, what would r… |
| 2076 | What is the difference and relationship between reservoirs and carriers?… |
| 2077 | The beneficial functions of <i>Staphylococcus epidermis</i>, part of the human microbiota, consist a… |
| 2078 | Chlamydia trachomatis affects all of the following areas except for _________.… |
| 2080 | Which is not involved with the pathogenesis of EHEC?… |
| 2082 | Which situation is an example of syntrophy?… |
| 2083 | Which step must occur for the body to kill host cells infected with Chlamydia?… |
| 2084 | When combating an epidemic, quarantine is:… |
| 2085 | Which of the following mechanisms are not used by T-cells or Antibodies to kill?… |
| 2089 | Which of the following type of vaccines utilizes parts (proteins, sugars, etc.) of a virus to grant … |
| 2091 | Which of the following is false regarding disease?… |
| 2092 | You work for the Wisconsin Department of Natural Resources and you are attempting to prevent Chronic… |
| 2095 | You work for the Wisconsin Department of Natural Resources and you are attempting to prevent Chronic… |
| 2096 | All of the following are ways pathogens evade the immune system EXPECT… |
| 2097 | Which of the following is true regarding carriers and reservoirs?… |
| 2098 | Which condition will produce the most atherosclerosis?… |
| 2100 | Which accurately represents a reservoir?… |
| 2102 | All of the following contribute to immunity, except?… |
| 2103 | You have a discovered a deadly, rapidly-spreading new virus in the melting glaciers that you call Pa… |
| 2104 | Which of the following cell types is NOT recruited in the inflammatory response?… |
| 2105 | Imagine you are a doctor working a small clinic. A young woman comes in with a high fever, multiple … |
| 2108 | Prior to the attack from a cytotoxic T cell, we need a signal that activates the T cell. Which of th… |
| 2109 | Which of the following ways would be the best way to stop the transmission of a prion-caused disease… |
| 2111 | True or False: Completely restricting travel of everyone, without any exceptions, in the affected ar… |
| 2112 | Which organ/tissue is NOT part of the secondary (peripheral) immune system?… |
| 2113 | Which of the following is NOT a metabolic trait that is shared between methanogenisis and acetogenes… |
| 2114 | <i>Akkermansia muciniphila</i> is… |
| 2115 | Fomites are an important aspect of pathogen transmission, which of the following is true about fomit… |
| 2116 | Fomites..… |
| 2117 | As a member of the CDC, news that several cases of measles have appeared within a city strike up a m… |
| 2118 | Mechanisms of pathogenesis of lyme disease include the following EXCEPT...… |
| 2121 | In what ways could a human be affected if all microbes were removed from their body?… |
| 2122 | At what stage would the highest amount of endotoxin be released?… |
| 2123 | Which is true regarding malaria?… |
| 2124 | A diet rich in phosphatidylcholine induces the risk of atherosclerosis.… |
| 2125 | A viral disease has emerged and infected a large portion of Madison. Due to commerce limitations tot… |
| 2127 | You are working in a laboratory that is trying to culture sulfate-reducing bacteria, from a sample c… |
| 2128 | You work as a microbiologist for the CDC. Your boss gives you a potentially disease causing microbe … |
| 2129 | How does <i>E. coli</i> attach and remain in the body?… |
| 2131 | Adam likes to hunt around the area of Southern Wisconsin. He is disappointed because some of the dee… |
| 2133 | The Human Immunodeficiency Virus (HIV) is a retrovirus. What is special about these viruses?… |
| 2134 | All of the following are true about <i>C. difficile</i>, except:… |
| 2136 | A study in mice is being conducted in which the microbiome of a thin mouse eating normal chow is tra… |
| 2137 | Which of the following is false regarding the microbiota of the gastrointestinal tract and the oral … |
| 2139 | Which of the following is FALSE about endotoxins and exotoxins?… |
| 2142 | HIV is a disease that can leave the host susceptible to ____… |
| 2143 | How does the type III secretion system (T3SS) enable Enterohemorrhagic E. coli (EHEC) to translocate… |
| 2144 | Shiga toxin, an example of an exotoxin, causes damage to the host by… |
| 2145 | Which of the following differences between humans and ruminant animals concerning their metabolic fu… |
| 2146 | Which of the following is NOT a way that environmental pathogens are transmitted?… |
| 2147 | This type of antibody is the first formed in a primary response and has a pentavalent structure (fiv… |
| 2148 | Of the following factors which one could slow the growth of a bacterium in a culture that is an acid… |
| 2149 | If you compare Bacteria, Archaea, and Eukarya a distinguishing characteristic of Eukarya is...… |
| 2151 | You are designing a new mesh to be placed on wounds. It works by blocking penetration by microbes. W… |
| 2152 | Understanding microbiology is important to society because (check all that apply)… |
| 2154 | Angelina Hesse learned how to keep substances solid from a neighbor when she lived in New York with … |
| 2155 | Louis Pasteur was researching what problem when he proposed the germ theory of disease?… |
| 2156 | Which of the following is a reason that the 16S rRNA sequence is useful in comparing the evolutionar… |
| 2157 | A mutation in an enzyme only allows a bacteria to make unsaturated fatty acids for the cell membrane… |
| 2158 | Observation of a bacterium on a solid surface shows that it is capable of motility. However, electro… |
| 2159 | You are on your way to your microbiology class when you trip and fall. The cut from your fall is 0.5… |
| 2160 | A researcher separated the chromosome from a non-membrane bound region in a prokaryote cell. What pa… |
| 2161 | Which function accurately matches the structure for all bacteria?… |
| 2162 | If you compare the structure of the Archaea cell membrane and cell wall to that of a Gram-positive B… |
| 2163 | Which of the following is not a type of motility found in bacteria?… |
| 2165 | Which of the following is/are true about Archaea?… |
| 2166 | Amidst the vast variability of viruses what structure can be found in nearly every virus?… |
| 2168 | The type of cellular transport that requires energy and facilitates movement against a concentration… |
| 2171 | Which of the following is not a mode of motility?… |
| 2172 | How is the function of type IV pili unique from that of both type I pili and flagella?… |
| 2174 | The major difference among the cell walls and cell membranes of Bacteria, Archaea, and Eukarya are… |
| 2175 | Egg whites have bacteria-fighting properties in them, such as lysozyme. This works by… |
| 2176 | Which of the following steps does NOT occur in all viral infections?… |
| 2177 | Which cellular transport system uses PEP(phosphotransferase) to get its energy in order to function?… |
| 2178 | The structure of peptidoglycan is best described as which of the following:… |
| 2179 | Which of the following bacterial cell types (Gram-Positive or Gram-negative) correctly matches the u… |
| 2180 | Consider the composition of cell membranes and cell walls of Bacteria, Archaea, and Eukaryotes. Whic… |
| 2183 | One basic building block of cells are lipids. Which of the following is a distinguishing characteris… |
| 2184 | Which of the following is NOT a mode of motility?… |
| 2185 | N-acetyl muramic acid and N-acetylglucosamine form an important structure for bacteria. Which of the… |
| 2187 | mRNA is one type of RNA. It is produced from the template strand in the ______ direction. In eukaryo… |
| 2189 | The term "microbe" describes a diverse array of organisms, but which of the following is the most ac… |
| 2190 | What does the conservation of glycolysis in living cells tell us about their phylogeny?… |
| 2191 | When comparing enzymes brought by Retroviruses and DNA viruses,… |
| 2192 | Which of the following is created by the misfolding of proteins in neurons?… |
| 2193 | Which of the following microscopes do not require you to stain the organisms in order to see them un… |
| 2194 | While reading a phylogenetic tree, you notice three descendants sprouting from a single node. This r… |
| 2195 | Both lipids and carbohydrates can be used as a form of energy storage within the cell. What are the … |
| 2196 | You have a 1 μm cut on your skin that has been infected. Which of the following microbe(s) could hav… |
| 2198 | Which bacteriophage(s) contain double-stranded DNA and can go thought a lytic cycle?… |
| 2199 | Which is a reason why staining is used in bright-field microscopy?… |
| 2200 | What are the major properties of agar that make it a better medium than gelatin?… |
| 2202 | A similarity between Gram positive and Gram negative bacterial cells is...… |
| 2203 | If you could not Gram stain a cell what kind of microscopy could you use in order to determine if a … |
| 2204 | A major difference between the cytoplasm of a bacteria cell and an Eukaryotic cell is that… |
| 2205 | In a bacteria cell, which of the following would increase the transcription of a gene?… |
| 2206 | At what stage in the virus life cycle does the virus insert its genetic material into the host?… |
| 2207 | Which organisms use ester-linked lipids in their cell membranes?… |
| 2209 | How is the work of Louis Pasteur and Robert Koch connected?… |
| 2210 | In DNA replication across the domains, What is the typical chromosome topology for Bacteria, Archaea… |
| 2213 | Which of the following is true about the Gram positive and Gram negative cell envelopes?… |
| 2215 | Which TWO structures can be found in both Gram-positive and Gram-negative bacteria?… |
| 2216 | <table class="table table-striped"> <tbody> <tr class="table_header"> <td> </td> <… |
| 2217 | If you were looking for another molecule besides the 16S rRNA gene to do phylogenetic classification… |
| 2218 | Surface layers… |
| 2219 | A mutation that completely inactivated one of the genes in the isoprene biosynthesis pathway would b… |
| 2220 | An aquatic bacterium may have a gas vesicle… |
| 2221 | In Gram-negative cells, transport proteins are found in the cytoplasmic membrane, but not in the out… |
| 2223 | The theory of endosymbiosis is supported by evidence that mitochondria and chloroplasts… |
| 2224 | DNA takes its double-helix shape due to ___________ and is stabilized by ________________.… |
| 2225 | The T4 virus is able to inject their genome into E. coli through what structure?… |
| 2226 | A new virus was discovered, upon further analysis it is found that it moves towards membrane envelop… |
| 2228 | Which of the following best describes the bacterial phylogenetic group, cyanobacteria?… |
| 2230 | The polar chemotaxis clusters function would best be described as (in a bacterial cell):… |
| 2231 | Which of the following microbes were most essential to the evolution of eukaryotes and subsequently … |
| 2232 | What structural aspect differentiates Gram-Positive and Gram-Negative Cells in a Gram test?… |
| 2233 | A researcher has discovered a new virus, but in order to access the genome for sequencing it require… |
| 2234 | Why was there a gap between when Thonis Philipszoon discovered microbes and when microbiology became… |
| 2235 | Which of the following is a correct description of agar?… |
| 2237 | One of the reasons DNA is used to store genetic information because it is less susceptible to what t… |
| 2238 | Microbes have a large impact on the environment. Which of the following is NOT a biological process … |
| 2239 | After a negative single-stranded RNA strand penetrates a host cell, what is the next step in its vir… |
| 2240 | Which of the following statements are true regarding prions?… |
| 2241 | A bacterium comes into contact with a negative chemical stimulus. In which way will its flagella rot… |
| 2242 | Which of the following is defined correctly and is unique to Gram Negative bacteria?… |
| 2243 | A new bacteria has been isolated and you are interested in viewing and studying the compartmentaliza… |
| 2244 | Phylogenetic trees inform us relationship between species. According to the phylogenetic tree of Euk… |
| 2245 | What is the function of FtsZ in a bacterial cell?… |
| 2246 | You believe that a new bacteria you discovered uses pili for movement. You want to use a microscope … |
| 2247 | You want to develop a new drug against HIV. What HIV protein would be a good target for this drug an… |
| 2248 | What would be the correct way to compare and contrast the cell membrane and cell wall of Bacteria, A… |
| 2251 | In ABC transport, what provides the energy that enables movement through the transport channel?… |
| 2252 | Which characteristic and description correctly matches their phylogenetic group in Archaea?… |
| 2253 | The repeatable two-dimensional crystalline structure found in many Bacteria and Archaea, but is not … |
| 2254 | Which of the following suggests mitochondria evolved from proteobacteria and chloroplasts evolved fr… |
| 2255 | Which of the following correctly matches the scientist to one of their major scientific contribution… |
| 2256 | When does the λ virus make the decision to become Lytic?… |
| 2257 | Which of these statements is best explains why 16S rRNA is a useful when comparing evolutionary rela… |
| 2258 | From the Domains of the phylogenetic tree of life _______________ are most similar in cell structure… |
| 2259 | You are working in a laboratory and discover a never before identified microorganism. After a prelim… |
| 2260 | Which of the following describes an accurate comparison of Gram-positive and Gram-negative cells?… |
| 2262 | A major reason why RNA is not used for genetic information is there is … |
| 2264 | A mutation in a bacterial cell's offspring has damaged and ultimately destroyed the cell's Type IV p… |
| 2266 | One of the differences between ABC transporter and group translocation is that?… |
| 2269 | A notable difference between the cell walls of Gram-negative and Gram-positive is that… |
| 2270 | The discovery of extreme thermophiles in Yellowstone, specifically the <i>Thermus aquaticus</i>, has… |
| 2271 | Which of the following phages can be translated right away when it enters a host?… |
| 2272 | What type of microscopy and sample preparation would be best for a researcher who wishes to visualiz… |
| 2276 | What are two most related organisms?… |
| 2282 | Which of the following characteristics are similar across prions and viruses?… |
| 2283 | Using the chart below, decode the following mRNA sequence into a 10 amino acid polypeptide. TTTTCUCT… |
| 2287 | <em>Myxococcus xanthus</em> is a Gram-negative, rod-shaped bacterium and is able to move using a met… |
| 2288 | The structure of DNA is crucial to successfully store information. Which of the following statements… |
| 2289 | Why are glycolysis and the Krebs cycle highly conserved in living cells?… |
| 2291 | Which of the following structures found in both Gram-negative and Gram-positive cells are matched wi… |
| 2292 | <img src="https://www.digitalatlasofancientlife.org/wp-content/uploads/2019/05/AnimalPhylogeny-Topol… |
| 2293 | Give an example of a phylogenetic group in the Archaea. List one distinguishing characteristic.… |
| 2296 | Which of the following is unique to gram positive cells and is responsible for making the cell wall … |
| 2298 | Which of the following statements about transcription initiation in bacteria is incorrect?… |
| 2299 | Which of the following best summarizes the evidence that mitochondria and chloroplasts evolved from … |
| 2300 | Given the following 16S rRna sequences, determine which two of the following sequences are most clos… |
| 2302 | What are the benefits of microbes in respect to agriculture?… |
| 2304 | How is rho-dependent termination different from rho-independent termination?… |
| 2305 | Which of the following is true about the ways microbes impact human lives?… |
| 2306 | Infectious particles that cause diseases such as Mad Cow Disease are...… |
| 2307 | When Gram staining bacteria, the crystal violet-iodine complex is retained primarily due to which st… |
| 2308 | A major difference between the composition of the lipid bilayer and permeability is that… |
| 2309 | You notice a bacteria moving around using an appendage. There is only one appendage and you notice a… |
| 2310 | The Anitcodon is presented to make the codon, which structure(s) are involved in this process?… |
| 2311 | <i>Lactococcus lactis</i> is a aertolerant anaerobe grows by fermentation. In the absence of oxygen,… |
| 2312 | Iron is an essential nutrient. In cells it is often involved in… |
| 2313 | Which of the following best describes the growth conditions required for purple bacteria?… |
| 2316 | Which of the following is NOT true for anoxygenic photosynthesis?… |
| 2317 | This protein complex is responsible for using the energy of photons to excite an electron in a magne… |
| 2318 | You need to measure the growth of a bacterium when it is in mid-log phase. It grows by binary fissio… |
| 2319 | Below is a recipe for a medium.</p> <p> </p> <table class="table table-striped"> <tbody… |
| 2320 | You increase the self-life of a Big Hearty Durian (a type of fruit) and do not want to alter the fla… |
| 2322 | A major difference between aerobic and anaerobic respiration is:… |
| 2323 | The catabolic maltose operon … |
| 2324 | A major difference of the cell structure and function between biofilms and planktonic cells is… |
| 2325 | Which of the following is a true statement about the difference between Retinal-based phototrophy an… |
| 2326 | Which of these environments would a bacterium that produces siderophores have an advantage?… |
| 2327 | In the data below which microbe has the higher growth rate and what is its approximate generation ti… |
| 2328 | Which of the following is an element of substrate-level phosphorylation?… |
| 2330 | You want to prepare milk for yogurt production. Which heat treatment would probably be the most usef… |
| 2331 | How do electrons flow through a respiratory chain?… |
| 2332 | A single cell of <i>Pseudomonas aeruginosa</i> settles down on a cell surface. What regulatory syste… |
| 2333 | Which of the following is used for classic photosynthetic light reactions but NOT necessary for reti… |
| 2335 | A major difference between retinal-based phototrophy(RBP) and classic photosynthesis is that… |
| 2336 | Tryptophan regulates its own synthesis in the <em>trp</em> operon by... (select all that are true)… |
| 2337 | The activities that are found in two-component systems are… |
| 2338 | Green bacteria and Cyanobacteria have similar light-harvesting (LH) complexes. What are some differe… |
| 2340 | The <i>lac</i> repressor protein controls expression of the lac operon by:… |
| 2342 | Which of the physical agents can reduce the microbial load in beer?… |
| 2343 | A discovered strain of <i>Vibrio fischeri</i> requires a higher cell population in order to biolumin… |
| 2344 | MacConkey Agar contains ingredients including neutral red and crystal violet and is used for the iso… |
| 2345 | A mutation that prevents DnaK from degrading the RpoH protein would… |
| 2346 | If there was a mutation in rpoH, so that its secondary structure did not melt at higher temperatures… |
| 2348 | You are looking to increase the shelf life of the oranges you just picked. What type of sterilizati… |
| 2349 | A major difference between sterilization and pasteurization is that… |
| 2350 | One milk sample was pasteurized and the another milk sample was sterilized in an autoclave. What is … |
| 2353 | A microorganism uses photosynthesis as a way to synthesize food for itself. It’s method of photophos… |
| 2355 | Which of the following includes the essential elements for microbes?… |
| 2356 | Which of the following causes protons to be pumped across the membrane during oxidative phosphorylat… |
| 2357 | Of the following responses which would be most beneficial to a cyanobacteria in an environment with … |
| 2360 | The lactose operon produces catabolic genes that degrade lactose and has a <i>lac</i> repressor prot… |
| 2361 | In <i>S. aureus</i> quorum sensing, a mutation in the histidine kinase sensor making it unable to ph… |
| 2362 | The binding at an allosteric site on an allosteric protein will result in:… |
| 2363 | In simple terms, photosynthesis is known as the process of turning light energy into the products AT… |
| 2365 | The impact to all microorganisms from lack of ability to get elements Carbon and Nitrogen into the c… |
| 2366 | Which of the following is NOT a role/function of Fe or Mg in enzymatic reactions?… |
| 2367 | You discover a new species of bacteria that uses organic compounds as both a carbon source and as an… |
| 2369 | I am running a business that sells milk in glass containers. What should my protocol be for controll… |
| 2371 | Scientists are studying a certain bacterium, which they have found to be a facultative anaerobe that… |
| 2374 | What is the growth rate of a bacterium if, at hour 5, it has 3.48E+07 CFU/ml and at hour 8, it has 2… |
| 2378 | The following carriers given are part of an electron transport chain. Given their reduction potentia… |
| 2380 | You have a culture of an aerobic halophile that you wish to maintain at its current population size.… |
| 2381 | A similarity between the Light-Harvesting Complexes of purple and green bacteria that differs in cya… |
| 2382 | A mutation occurs in the Quorum sensing regulation pathway of <i>Vibrio fischeri</i> in which the ac… |
| 2383 | Describe this reaction: O<sub>2</sub> + 4H<sup>+</sup> +4e<sup>-</sup> -> H<sub>2</sub>O… |
| 2384 | Rachel is in a food science lab and must design an experiment in which she uses ionizing radiation t… |
| 2385 | A deletion mutation occurs in <i>trpR</i> so that the tryptophan repressor is always bound to trypto… |
| 2386 | Which of the following does NOT happen in negative regulation when an inducer binds to the repressor… |
| 2387 | Which form of radiation is used more for prevention of microbial growth in food, and why?… |
| 2389 | Which of the following descriptions about the proton motive force and ATP synthase is INCORRECT?… |
| 2390 | A beer brewer adds more sugar than normal during fermentation and notices that the end product has a… |
| 2391 | Why are cells more likely to survive when subjected to low temperatures versus extreme high temperat… |
| 2392 | What happens if the <i>lac</i> repressor doesn't bind to allolactose?… |
| 2393 | A strong biocide kills most, but not all, microbes on a glass surface. What method of control is thi… |
| 2395 | The major differences between negative and positive regulation of gene expression in microorganisms … |
| 2397 | Which of the following statements is true in terms of physical methods for microbial growth control?… |
| 2398 | If there is a deletion mutation in the <i>malT</i> gene in the maltose operon, what would be the phe… |
| 2401 | As a result, a cell produces a net 2 ATP instead of 1 ATP. Which glycolytic pathway did the cell und… |
| 2403 | A microbiologist went out to some acid mine drainage to see if there were any organisms living in th… |
| 2404 | The binding of maltose to the MaIT protein recruits which enzyme?… |
| 2405 | A microbiologist is studying an organism that uses light to make their energy, uses carbon dioxide, … |
| 2406 | A mutation is observed in the region of the adenine efflux pump gene (ydhL) that inhibits adenine fr… |
| 2407 | Which of the following would occur if maltose was blocked from binding to the maltose activator prot… |
| 2410 | In <i>Vibrio fisheri</i>, which of the following would most directly result in reduced synthesis of … |
| 2411 | In Lactic Acid Fermentation, there is an oxidation of ________ to form NAD<sup>+</sup> and a reducti… |
| 2412 | When preparing milk that is meant to be refrigerated, which method of antimicrobial control would be… |
| 2413 | Redox reactions are happening in abundance in cells. Which of the following is an example of an oxid… |
| 2414 | If an antisense RNA somehow was switched from cis to trans, how would this affect the mRNA?… |
| 2415 | <i>Euprymna scolopes</i>, a Hawaiian squid species, will uptake <i>Vibrio fischeri</i> only when...… |
| 2416 | If an organism prefers to grow and survive at cold temperatures, which of the following best describ… |
| 2419 | While isolating a specific bacteria species, you decide to add an antibiotic to the media. What type… |
| 2421 | The difference between a chemoautotroph and a chemoheterotroph is that… |
| 2424 | If antisense RNA binds to its target ______ less strongly, ______ will be inhibited less, and the pr… |
| 2426 | Which of the following fermented food requires the most complicated fermentation process?… |
| 2427 | What kind of metabolic pathway would a cyanobacteria undergo given normal light and nutrient conditi… |
| 2428 | Which statement about biofilms and planktonic cell is correct?… |
| 2429 | An microbe is placed in an environment in which the hydrogen ion concentration is very high and disp… |
| 2430 | What is <b>not</b> a unique component of the light-harvesting centers in green bacteria?… |
| 2431 | In catabolite repression, a IlA-Glc is phospohorylated due to a lack of glucose which allows adenyla… |
| 2432 | You identify Cyanobacteria in a cell culture. After performing some experiments, you find that the C… |
| 2433 | What would happen to transcription levels in the lac operon if allolactose could no longer bind to L… |
| 2434 | Which of these is specific to planktonic growth that is not specific to biofilms?… |
| 2435 | Which of the following growing conditions will not slow down the growth rate of Psychrophiles?… |
| 2436 | A scientist is trying to kill endospores in a petri dish. What is the only effective way to do so?… |
| 2437 | You want to make a big batch of apple juice at home so you can sell it at your local farmers' ma… |
| 2439 | A major difference between micronutrients and trace elements is...… |
| 2441 | Fermentation is an energy producing process where… |
| 2444 | If a mutation in the <em>rpoH</em> gene caused increased stability of the secondary structure of the… |
| 2447 | A new bacterium has just been isolated. <em>Homangi funkii.</em> It was determined to have four circ… |
| 2448 | High copy number plasmids maintain themselves by...… |
| 2449 | A strand of DNA has the following mutation:</p> <img src="/instr/images/quickcheck/T-T-dimer.png" /… |
| 2450 | What is the main difference between chromosomes and plasmids?… |
| 2451 | A true statement about microbes and their key processes in the nitrogen cycle is that … |
| 2453 | Several types of bacteria live on our skin and inside our mouths, noses and throats - in exchange fo… |
| 2455 | Which of the following is NOT a feature we would find in a plasmid?… |
| 2457 | How do anaerobic bacteria benefit from the production of cellulosomes?… |
| 2458 | In a community that contains sulfate ions, microbes will degrade polymers like cellulose, chitin, an… |
| 2459 | Both the oral cavity and the gastrointestinal tract are home to a variety of different microbial spe… |
| 2461 | There are many functions provided by symbiotic microbes to their host. Match one of these functions … |
| 2463 | What repair system would fix a mutation with pyrimidine dimers which was caused by exposure to UV li… |
| 2464 | When comparing the respiratory chain of an iron-oxidizing microbe to that of a typical microbe, whic… |
| 2466 | You are trying to classify a species. The phenotypic tests show the bacterium is able to ferment lac… |
| 2467 | You want to find a heat-stable amylase enzyme for your candy company. You have a new thermophile, <e… |
| 2468 | Where would you place <em>Phanerochaete chrysosporium</em> in a community physiology diagram?… |
| 2469 | You want to examine the structure of an acid mine biofilm and determine the quantity and location of… |
| 2471 | White rot fungi use lignin peroxidase to...… |
| 2472 | What would happen to a cow's nutrition levels if its diet was changed from hay and grass to fresh fr… |
| 2473 | For a wild type bacterium that uses lactose as an energy source, which of the following would NOT ac… |
| 2474 | How are transformation and transduction similar?… |
| 2475 | The ________ component of the CRISPR system has the potential to be hazardous because ________… |
| 2476 | A unique feature of the oral cavity compared to the rest of the GI tract is...… |
| 2477 | Which of the following ocean-dwelling bacteria gain at least part of their energy from sunlight? Sel… |
| 2479 | How would a human be harmed if all of the microbes were removed?… |
| 2480 | Which of the following correctly identifies a microbe and its physiological role in a <strong>lake</… |
| 2481 | One difference in an iron-oxidizing microbe in an acid mine versus a typical microbe is that...… |
| 2482 | Which of the following is true regarding the steps in energy production by the bacteria in tube worm… |
| 2484 | You investigate an anaerobic sample with high concentrations of carbon dioxide and hydrogen and low … |
| 2485 | You are tending to your garden and you decide to add compost. Your compost is made up of every… |
| 2486 | Which of the following is a correct comparison between methanogens and acetogens? … |
| 2487 | The example of syntrophy we looked at in class involved converting … |
| 2490 | You are studying a microbe capable of metabolizing lactose, but a new colony is suddenly unable to d… |
| 2491 | Which of the following is true in both mechanisms of photosynthesis and bacteriorhodopsin?… |
| 2492 | What energy is available for organisms in the deep sea versus for primary producers in a lake?… |
| 2493 | Aphids, which are sap-sucking insects, will have symbionts in bacteriocytes. The Beewolf digger wasp… |
| 2494 | Humans with severe combined immunodeficiency have ineffective immune systems. They must live in ster… |
| 2496 | Although they are in very different environments, what is similar between primary producers at deep … |
| 2497 | Trimethylamine oxide (TMAO) is directly related to the intake of phosphatidylcholine by an animal, l… |
| 2498 | If you compare the microbiota of a cow and a human, you will find that… |
| 2499 | A thin person eats a diet rich in fruits and vegetables. An obese friend consumes a high-fat diet. A… |
| 2500 | If you take the microbiome of a depressed human and transplant it into a mouse, the mouse will… |
| 2501 | Which cellulose degradation system is the most efficient, and why?… |
| 2502 | Sap-sucking or blood-sucking insects and their relationship to microbes differ from Beewolf digger w… |
| 2503 | You want to select for <em>Escherichia coli</em> which you know has a pink gram stain. Which selecti… |
| 2505 | When considering a syntrophic culture of <em>Syntrophomonas</em>, what acts as the producer and… |
| 2506 | Which of the following components are commonly found in plasmids?… |
| 2507 | Which of the following is NOT a similarity between the respiratory chain of an iron-oxidizing microb… |
| 2508 | What is/are potential benefit(s) of CRISPR system? </p> <p> </p> <p> … |
| 2509 | <em>Akkermansia muciniphila</em> is a part of the GI tract microbiome. In a person with a GI disease… |
| 2512 | How do Bacteria and Eukarya differ in using the CRISPR/CAS9 system for repair?… |
| 2513 | Transduction, transformation, and conjugation are all types of _______. However, ________ requires c… |
| 2514 | <em>Bathymodiolus</em> mussels have a symbiotic relationship with the sulfide-oxidizing and methane-… |
| 2515 | Which of the following traits do both microbial chromosomes and plasmids share?… |
| 2518 | Thinking back to <em>Vibrio fischeri</em> and the Hawaiian squid, what kind of symbiosis best descri… |
| 2519 | You are taking a survey of the oral microbiota of several patients at a dentist. You are interested … |
| 2522 | In the spring of 2018, histopathological investigations revealed damage to the gills, digestive trac… |
| 2524 | You are a scientist and you want to explore the microbiome. You collect ten people and take a sample… |
| 2527 | If all microbes were removed from the human body, which function would NOT be affected?… |
| 2528 | The iron-oxidizing microbe shares common aspects with the oxidative phosphorylation system in what w… |
| 2530 | Which of the following is a correct statement about the nitrogen cycle?… |
| 2532 | Which of the following horizontal gene transfers involves a bacterial cell picking up naked DNA from… |
| 2534 | If you wanted to test if a mouse had anxiety, what is the correct match between the type of test and… |
| 2535 | A decrease in consumption of cheese and dairy (phosphatidylcholine) has which effect?… |
| 2536 | Which of the following is a true statement regarding the tests conducted on mice to measure depressi… |
| 2537 | A cow suddenly changes its diet so it no longer eats any plant material. What happens to its nutriti… |
| 2538 | Which of the following is false regarding plasmids and how they work within their host cell?… |
| 2539 | The Griffiths experiment demonstrated that...… |
| 2540 | How do cellulosomes contribute to cellulose degradation?… |
| 2542 | When comparing metabolic microbes in humans to those in ruminant animals...… |
| 2543 | An error occurred where pyrimidine dimers are formed. Which of the following likely caused this muta… |
| 2544 | A bacterium (<em>Mikus leckronicus</em>) is isolated from the mouth of a Badger, particularly in moi… |
| 2545 | Which of the following would NOT contribute to a cyanobacteria bloom in a lake?… |
| 2547 | The relationship between mites that live from eating dead skin and the humans they live on who do no… |
| 2548 | If one wanted to clone a gene that would give a bacteria antibacterial resistance, a given ______ wo… |
| 2549 | If a mutation occurred in the gene encoding rhodopsin in all bacteria (i.e. bacteriorhodopsin) prese… |
| 2551 | How does the presence of a methanogen help <em>Syntrophomonas?</em>… |
| 2552 | A plasmid most likely has this type of DNA… |
| 2554 | Methanogens and Acetogens compete for CO<sub>2</sub> and H<sub>2</sub>. Which of the following is co… |
| 2556 | <em>Bathymodiolus </em>mussels are commonly found near hydrothermal vents on the ocean floor. Which … |
| 2558 | All are true regarding the CRISPR mechanism except..… |
| 2559 | Acetate, propionate, and butyrate are all products of the microbial fermentation that take place in … |
| 2561 | You want to design an experiment to clone a target gene and produce proteins. Which of the steps giv… |
| 2562 | Which of the following sets of microbe, substrate, and product combinations are correct for the… |
| 2563 | Researchers just discovered "plasmid X", which is found in the genome of <em>Badgercoccus … |
| 2565 | Which of the following best describes the relationships between the photosynthetic process used by p… |
| 2568 | You want to study a type of <em>Pelagibacter</em> living in the ocean and its metabolism, espec… |
| 2569 | Why do fish die after a cyanobacterial bloom and crash?… |
| 2573 | What are two functional mechanisms plasmids use to maintain themselves in host cells?… |
| 2574 | In bacteriorhodopsin, light striking the protein causes a pmf by:… |
| 2575 | You are replicating the classic Luria-Delbruck experiment. Ten cultures of <em>E. coli</em> are grow… |
| 2576 | A difference between neutrophils and macrophages is… |
| 2577 | After differentiation, immature T-cells go through an education process in the… |
| 2578 | Which of the following is how neutrophils will react upon infections?… |
| 2579 | A deadly pathogen, <i>B. Badgeri<strong>, </strong></i>is fatal to the host if it invades and c… |
| 2580 | Which type of immune response listed below is are inducible and are part of the adaptive immune resp… |
| 2581 | The skin protects us from pathogens by (three answers are correct)… |
| 2582 | Our bodies have many physical barriers to pathogens. These include: (There are three correct answers… |
| 2583 | Match the antimicrobial secretion with its activity… |
| 2584 | The complement cascade can be triggered by (two answers are correct)… |
| 2585 | Phagocytes are attracted to pathogens by… |
| 2586 | What measures could you take to control the current epidemic of COVID-19?… |
| 2587 | A Pattern Recognition Receptor will react with… |
| 2588 | These cells can present antigens to T-cells <strong>and</strong> B-cells (There are two correct answ… |
| 2589 | A major difference between SARS-CoV-2 (COVID19) the Rhinovirus and Influenza A is?… |
| 2590 | T-cells activate when an antigen is presented to them in the context of… |
| 2591 | When B-cells activate, they differentiate into (there are two correct answers)… |
| 2592 | These antibodies have 10 antigen-binding sites.… |
| 2593 | What is true of elementary bodies in the context of chlamydia?… |
| 2594 | In investigating the transmission of SARS-CoV-2 (COVID-19), which of the following is probably not a… |
| 2595 | Pathogenic <em>E. coli</em> strains often have fimbriae as virulence factors. What step of infection… |
| 2596 | TcdA and tcdB are proteins that disrupt Rac and Rho GTPases in cells. They are examples of… |
| 2597 | Match the cause of the illness with disease symptom(s)… |
| 2599 | What does NOT describe B-lymphocytes?… |
| 2600 | When enterohemorrhagic <em>E. coli</em><em> </em>infects the small intestine, it is difficult for th… |
| 2601 | Even though this bacterium is a strict anaerobe, it still transmits easily because it can form endos… |
| 2602 | Some people fear that SARS-CoV-2 (COVID-19) will mutate over time (as the flu virus does) making rep… |
| 2603 | Match the pathogen with its treatment… |
| 2604 | A characteristic of neutrophils that does not apply to macrophages is:… |
| 2605 | Pattern Recognition Receptors (PRR) are a family of receptors that are present on immune cells … |
| 2606 | Which innate immune response do PRRs (Pattern Recognition Receptors) participate in?… |
| 2607 | When someone gets the common cold which of the following is not a step of an adaptive response to fi… |
| 2608 | You’re walking through the Arboretum with a friend when an angry badger jumps out and bites yo… |
| 2609 | What are prions and why are they so dangerous? … |
| 2611 | Which of the following is true regarding the activity of MAMPs and DAMPs during the immune response?… |
| 2612 | The overuse and misuse of antibiotics causes pathogens to become _____, which can be mitigated by __… |
| 2613 | One complication that may occur when an individual is infected with <em>Clostridium difficile</em> i… |
| 2614 | You are a doctor at UW Hospital. A patient comes in with a sexually transmitted disease. You perform… |
| 2616 | You are hiking at Wyalusing State Park along the Mississippi River during the spring to get some fre… |
| 2617 | You are the president of the United States, what the most effective method of slowing the spread of … |
| 2618 | What usually must happen upon attachment and entry of a host cell by a pathogen? … |
| 2620 | In developed cities, water is first treated with chlorine, lime and alum and put in sedimentation ba… |
| 2621 | Which of the following is a possible molecular mechanism microbes use to develop resistance to antib… |
| 2622 | Regarding the difference between dendritic cells and macrophages, which of the following is true?… |
| 2623 | The reason COVID-19 can be deadly to people with autoimmune conditions is because...… |
| 2625 | A major step in water processing before it is consumed by humans is that … |
| 2626 | A number of vaccines are being created for SARS-CoV-2 (COVID-19). The best vaccine against this viru… |
| 2627 | Moderna Inc. has developed an mRNA vaccine that when injected into patients causes host cells to mak… |
| 2628 | Match the antibiotic with its target… |
| 2629 | A successful strategy for slowing the development of antibiotic-resistant bacterial strains is… |
| 2630 | Molecular mechanisms for antibiotic resistance include:… |
| 2631 | Which of the following statements regarding John Snow's studies of water quality is TRUE?… |
| 2632 | Which of the following describes the role of the secondary immune system?… |
| 2633 | Which of the following is NOT a component of the IgG antibody?… |
| 2634 | Which of the following is a function of the IgG monomer antibody?… |
| 2635 | Which of the following is the target of β-lactam, an antibiotic?… |
| 2637 | Which of the following types of vaccine is matched INCORRECTLY with its example?… |
| 2638 | Which of these are indirect ways a disease can be transmitted from person to person?… |
| 2639 | Which of the following is <strong>NOT</strong> an effective way to combat antibiotic resistance… |
| 2640 | To cause disease, a pathogen must be transmitted from its reservoir to a host. Why is pathogen trans… |
| 2641 | What is a function of CD-8<sup>+</sup> T lymphocytes?… |
| 2643 | Which correctly describes exotoxins and/or endotoxins?… |
| 2644 | Which of the following actions would you not expect an immune hormone (a cytokine) to be involved in… |
| 2645 | Which of the following antibiotics target DNA replication by inhibiting topoisomerases?… |
| 2646 | Which of the following would be the best mitigation method for an outbreak of Malaria?… |
| 2647 | You are working with a patient who has become ill from <em>Badger fisheri, </em>a bacteria… |
| 2648 | You are enjoying the summer weather outside with a long walk throughout a park in Northern Wisconsin… |
| 2650 | One major difference between CD4<sup>+</sup> and CD8<sup>+</sup> cells is...… |
| 2651 | During a primary response, B cells differentiate into plasma cells and secrete what antibo… |
| 2652 | Which of the following statements about phagocytes is incorrect?… |
| 2653 | During infection, the role of neutrophils does <strong>not</strong> include… |
| 2654 | How do better living conditions and improved nutrition limit the spread of disease?</p> <p> … |
| 2655 | Which of the following is FALSE regarding how T-cells sense a host cell is infected?… |
| 2656 | What are some of the features and their roles of the skin that protect against microorganisms?… |
| 2657 | Every year, the public is advised to receive a vaccine for Influenza in order to prevent the number … |
| 2659 | Which of the following is not a process in T-cell maturation?… |
| 2660 | During the sanitation process of water, which of the following are not added to the sedimentation ba… |
| 2661 | What is a distinctive feature that SARS-CoV-2 (COVID-19) has that other common viruses do not have?… |
| 2662 | Which of the following is CORRECT about Influenza A?… |
| 2663 | Human Papillomavirus (HPV) is a common cause of ________. It causes this by integrating into the gen… |
| 2664 | In the complement cascade...… |
| 2666 | Which of the following is <strong>not</strong> an element of T cell activation and activity?… |
| 2670 | Why is <em>Borrelia burgdoferi </em>able to so easily spread through the skin and blood du… |
| 2671 | Which of the following statements is false regarding Rhinoviruses?… |
| 2672 | You experience an gut infection in the mucosal membrane. Which type of antibody would you most like… |
| 2674 | The enzymatic system is a part of the complement system, and has 9 proteins. Which of the … |
| 2679 | Which type of cell is the first to detect pathogens and activate the adaptive immune system?… |
| 2681 | Chronic Wasting Disease (CWD) in deer, elk, and moose populations currently has no known forms of tr… |
| 2682 | Which of the following correctly outlines differences between live attenuated vaccines and dead viru… |
| 2685 | Which of the following components of the skin listed below is incorrectly defined in how it acts as … |
| 2686 | There are numerous types of DNA viruses present. Papillomaviruses are significant compared to other … |
| 2687 | Endotoxins are found in <em>Escherichia coli</em> and...… |
| 2688 | Which of the following regarding rhinovirus is INCORRECT?… |
| 2689 | You are cutting an apple and all of a sudden the knife slips and you cut your finger. Pathogens begi… |
| 2690 | Which of the following is NOT a molecular mechanism of acquired antibiotic resistance employed … |
| 2691 | Neutrophils are… |
| 2692 | What is the correct statement regarding the process and function of natural killer cells?</p> <p>… |
| 2693 | <em>Chlamydia trachomatis</em> is a common STI that is one of the leading causes of pelvic… |
| 2694 | Which of the following is a good method for controlling a viral epidemic?… |
| 2695 | Which of the following does not correctly match the body part and its movement to functionally prote… |
| 2696 | The early epidemiology investigation conducted by John Snow proved what about the association betwee… |
| 2698 | What makes a natural killer cell similar to a cytotoxic T cell? … |
| 2699 | Which cell is an antigen presenting cell and what role do they play?… |
| 2700 | Which of the following complement proteins enhances the phagocytosis of macrophages?… |
| 2701 | Which of these processes is used when the immune system is fighting an extracellular pathogen and wh… |
| 2702 | The virulence of <em>Borrelia burgdorferi </em>is unusual because it does not produce or u… |
| 2704 | The TLR1:TLR2 heterodimer is usually present within host cells. Considering that this pattern recogn… |
| 2706 | How do component vaccines work?… |
| 2707 | What measures could you take to control the current epidemic of COVID-19?</p> <p> </p> <p… |
| 2708 | Which of the following proteins involved in the complement system is known to coat the bacterial cel… |
| 2709 | What is the role of opsonin’s in aiding phagocytosis?… |
| 2712 | What is the most distinguishing feature of a type III secretion system, and what is its function in … |
| 2717 | In the activation of B lymphocytes, binding of the antigen immediately causes...… |
| 2720 | Which of the following is <strong>NOT</strong> a mechanism used by microbes as method of antibiotic … |
| 2722 | We learned of two pathogens that cause diarrhea. What makes <em>C. difficile</em> different from <em… |
| 2723 | Studying microorganisms is worthwhile because… |
| 2724 | What makes bacteria great model organisms?… |
| 2725 | These structures can function to make a microorganism motile… |
| 2726 | These structures can serve as methods of attachment in bacteria.… |
| 2727 | This structure is involved in fatty acid and phospholipid synthesis in eukaryotic cells… |
| 2728 | DNA needs to be condensed and highly organized in cells. In bacteria this is accomplished by what tw… |
| 2729 | Look at the following sequence</p> CATACATA<strong><span style="background-color:#1abc9c;">TTGAC… |
| 2730 | A distinguishing feature between DNA and RNA is that DNA is double-stranded and RNA is not… |
| 2731 | The evidence in support of Dr. Lynn Marguilis' endosymbiosis hypothesis is that mitochondria and chl… |
| 2732 | Which of the following are traits of the Actinobacteria?… |
| 2733 | All of the following are traits of the Actinobacteria except for...… |
| 2734 | These Archaea produce methane as a product of their metabolism… |
| 2766 | Without carotenoids, a plant could not effectively (check all that are correct):… |
| 2767 | The adenine pump's gene expression is turned on when adenine rises to a high enough level in the cel… |
| 2768 | In Gram-positive quorum sensing, such as that observed for <em>Staphylococcus aureus</em>, RNA III r… |
| 2769 | Imagine you have an <em>E. coli</em> strain where the <em>crp</em> gene that encodes the cAMP recept… |
| 2770 | In <em>E. coli </em>the heat shock response is regulated (select all that are true)… |
| 2771 | You have isolated a novel, Gram-negative, lignin-degrading bacterium, but have not obtained its sequ… |
| 2772 | Which of these sequencing methods uses a pore that the DNA runs through and determines the sequence … |
| 2773 | <i>Leptospirillum</i> <em>ferroxidans</em> are found in the acid mine. Select the statements that ar… |
| 2774 | An example of an Archaeon that is found in the acid mine that does not contain a cell wall is… |
| 2775 | <i>Peligabacter ubique</i> is (Check all that apply)… |
| 2776 | Some nitrogen-fixing bacteria enter mutualistic relationships with plants. Some animals also have mu… |
| 2778 | <strong>Strong</strong> evidence that the microbiome has a role in depression is...… |
| 2779 | The most likely explanation for the large time gap between Thonis Philipszoon viewing microbes and s… |
| 2780 | What do Gram-Negative and Gram-Positive cell membranes have in common?… |
| 2781 | From a human perspective, which of the following are helpful activities of microbes? (Choose all tha… |
| 2782 | Match the scientist to their discovery… |
| 2783 | Amino acids are monomers that are used in (select all that are true)… |
| 2784 | Arrange the steps of viral infection in the correct order.… |
| 2785 | Viruses can have various structures that enclose the viral nucleic acid. These include (select all t… |
| 2786 | The SARS-CoV-2 virus is a single-stranded, (+) strand RNA virus. Therefore it must… |
| 2787 | Which is not true about the relationship between prions and viruses?… |
| 2788 | You are studying an unknown bacteriophage's replication cycle. In looking at the viral genome, you … |
| 2790 | Endotoxins are long lipopolysaccharide molecules anchored to the outer membrane of certain types of … |
| 2792 | A key difference when comparing the differences between the structures of lipid and sugars is … |
| 2795 | A similarity between the structures of nucleic acids and polysaccharides are that they...… |
| 2796 | What do archaea cell membranes have that bacteria and eukaryote cell membranes are lacking?… |
| 2797 | A single-stranded negative RNA virus needs it's own DNA polymerase, but a single-stranded positi… |
| 2798 | Why is DNA used to store hereditary information?… |
| 2799 | Why are microbes limited in their size range?… |
| 2800 | What is the relative size range of most microbes?… |
| 2801 | Some Archaea are uniquely adapted to survive extreme environments. Which modification best allows fo… |
| 2803 | Suppose you discovered a new microbe (Microbe X). Someone asks you why this is important, you answer… |
| 2804 | Which of the following structures or molecules are present within the cells of <stron… |
| 2806 | All of these are problems with this definition of a species “Bacterial and Archaeal species ar… |
| 2808 | Which statement is correct regarding the difference between bacterial swimming and twitchi… |
| 2809 | Microbes impact human lives by... (Select all that apply.) … |
| 2810 | What did Edward Jenner inject his young patient with in order to improve on variolation? … |
| 2811 | A Gram-positive bacterial cell had prolonged exposure to lysozymes. How will the staining of th… |
| 2812 | As a curious young researcher you decide to swab the surface of your phone, directly rub this onto a… |
| 2814 | In order for microbes to be observed in the laboratory, a suitable medium needed to be developed. Wh… |
| 2816 | All of the following are true concerning the contributions of microbes except, … |
| 2817 | Which of the following are functions of a cellular membrane?… |
| 2818 | One major difference between a prion and a virus is that… |
| 2820 | Which of the following is NOT found in the densely packed cytoplasm of bacteria?… |
| 2822 | <img alt="" src="http://organismalbio.biosci.gatech.edu/wp-content/uploads/2018/12/1600px-Phylogenet… |
| 2823 | Prions are different from viruses in that they...… |
| 2824 | What microbial discovery allowed Carl Woese to introduce the three Domain concept?</p> <p> <… |
| 2826 | While they are both phages, the lambda phage and T4 phage differ because... … |
| 2827 | What would happen if the promoter sequence of a gene was mutated so that RNA polymerase almost never… |
| 2828 | Which of the following is NOT a similarity between T4 and λ?… |
| 2831 | Which of the following is the correct pair of differences between viruses and prions?… |
| 2832 | Determine the sequence of the amino acid chain using the following mRNA molecule. Begin at the first… |
| 2833 | One way to characterize Bacterial and Archaeal species was when there was more than 70% DNA hybridiz… |
| 2834 | Suppose you isolate protein from a new strain of bacteria. You hypothesize that this enzyme catalyze… |
| 2835 | Which of the following uses rotary motion to push or pull the cell?… |
| 2838 | Which of the following is more likely to be found in a Gram-Positive membrane than a Gram-Negative m… |
| 2839 | What is the correct order of steps in a viral infection and release of a lysogenic phage such as λ?<… |
| 2840 | Why do both bacteria and eukaryotes have the Krebs/Citric Acid cycle if only eukaryotes have mitocho… |
| 2841 | Select each answer that correctly matches a structure of the Gram-negative or Gram-positive cell and… |
| 2842 | Select all the ways that microbes can impact our lives … |
| 2843 | An abundant phylogenetic group of Archaea called the methanogens is known for producing methane. For… |
| 2844 | Lysozyme targets peptidoglycan and is therefore most effective in degrading the cell envelope o… |
| 2845 | Below is a DNA sequence of the coding strand of a gene. Using the DNA sequence, find the a… |
| 2846 | What would be a downfall of failing to stain a specimen when observing it with a bright-field micros… |
| 2847 | All of the following are true of a eukaryotic cell membrane except...… |
| 2848 | Using a symporter in facilitated diffusion, all of the following statements are true except...… |
| 2852 | Carl Woese's use of 16S rRNA was very beneficial in his studies of evolutionary relationshi… |
| 2855 | Which of the following is true regarding the peptidoglycan layer in Gram-positive or Gram-negative b… |
| 2856 | <em>Rhizobia</em> are bacteria that participate in Nitrogen fixation after establishing themselves i… |
| 2857 | Which of the following statements is TRUE of the S-Layer on the outside of the phospholipid bilayer … |
| 2860 | Four 16S rRNA sequences are obtained. You need to decide which two are the most related and which tw… |
| 2862 | Your roommate was told to culture a new penicillin-resistant bacteria, and determine whether th… |
| 2863 | Prior to technology to sequence RNA, what evidence did scientists have for the theory that mitochond… |
| 2866 | Regarding the steps of a viral infection, which one of the following lists the steps in the correct … |
| 2869 | Which of the following methods of passing through a cell membrane does <strong>not</strong> require … |
| 2871 | The phyla Crenarchaeota contain a cell membrane composed of lipids. How are the lipids linked and wh… |
| 2873 | Match the viruses to the characteristics specific to them.… |
| 2874 | The human rhinovirus (also known as the common cold), a single-stranded RNA eukaryotic virus, m… |
| 2877 | You are trying to derive the evolutionary relationship between 5 closely related bacteria cells. Wha… |
| 2878 | One cell structure that is unique and distinguishes the cyanobacteria group is...… |
| 2879 | What is a cellular structure that can be found and used to distinguish the family of the Firmic… |
| 2880 | Pick the structure that corresponds with the proper function.… |
| 2882 | Select all of the following ways that microbes impact our lives.… |
| 2885 | You have been tasked with investigating the structure of a specific membrane protein in a bacterial … |
| 2888 | If a bacterium with type IV pili needs to slowly move across a surface, what type of motil… |
| 2890 | Some bacteria are known to cause disease and infection in humans, and therefore must be able to get … |
| 2892 | Where is the periplasm located?… |
| 2893 | Which of the following is true about the initiation stage of transcription in Archaea? … |
| 2897 | What features of the 16S rRNA would<strong> not </strong>make it useful to compare the evolutionary … |
| 2898 | When 16s rRNA of a chloroplast was originally sequenced and aligned with that of bacteria, it was fo… |
| 2900 | Which is an enzyme that humans produce, as discussed in lecture, that is a threat to many bacteria?… |
| 2901 | Which of the following statements is false regarding the use of bright-field microscopy?… |
| 2904 | Which two organisms are the most and least closely related based on the following 16S rRNA sequences… |
| 2905 | Energy, such as ATP and high-energy compounds, is necessary for transporting macromolecules via the … |
| 2906 | Which option does NOT is not a valid piece of evidence that supports that mitochondria evolved from … |
| 2907 | Pili and flagella share these functions in common… |
| 2908 | If a bacterial cell was starved for iron in a system, which of the following systems would be greatl… |
| 2909 | All of these are true regarding substrate level phosphorylation (SLP) EXCEPT:<… |
| 2910 | The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c… |
| 2911 | The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c… |
| 2912 | The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c… |
| 2913 | Microbes can be found in even in your refrigerator! Which of the following would best describe the m… |
| 2915 | <img alt="Fermentation - Chemistry LibreTexts" src="https://instruction.bact.wisc.edu/vmicro/web/ima… |
| 2917 | All the following are end products of Heterofermentation except… |
| 2918 | <img alt="CELLULAR METABOLISM AND FERMENTATION" src="https://instruction.bact.wisc.edu/vmicro/web/im… |
| 2919 | You are brewing a batch of 10 Forward Brown Ale (yes that is a Next Generation reference) that you b… |
| 2920 | Your friend wants to make cheese, but instead of milk they want to use unsweetened almond milk (0.41… |
| 2921 | The electrons on electron carriers such as NADH are donated to the electron transport chain. During … |
| 2922 | Substrate-level phosphorylation (SLP). (Check all that apply)… |
| 2923 | A major difference between anoxygenic photosynthesis and oxygenic photosynthesis is that:… |
| 2924 | Which of the following statements is true about turbidity in measuring microbial growth?… |
| 2925 | You have a microbe that does not divide by binary fission, but instead forms long filaments. How cou… |
| 2926 | High temperatures kill microorganisms by… |
| 2927 | You want to ship your freshly picked, and packed strawberries across the country. Before you do, wha… |
| 2928 | Which of the following <strong>do not</strong> describe the roles of Fe or Mg in enzymatic reactions… |
| 2929 | Which of the following elements are considered macronutrients?… |
| 2930 | What is true of the photophosphorylation reaction center of oxygenic cyanobacteria?… |
| 2931 | If you increase the concentration of the substrate in a reaction, what happens to the rate of the re… |
| 2932 | Your area has suffered a hurricane and the power is out. It appears that it will be out for at least… |
| 2933 | In the formation of ethanol, glucose undergoes catabolism to create pyruvate. The pyruvate is decarb… |
| 2934 | If you sterilize milk using ultra-high-temperature pasteurization (140-150 &deg;C for 3 second) … |
| 2935 | You have isolated 2 new microbes from Yellowstone National Park. You want to classify them, so you t… |
| 2937 | Here are two half reactions. Predict which way the reaction would go and what the half reactions wou… |
| 2939 | A difference between cells in biofilms and planktonic cells is that...… |
| 2940 | The blue-green algae blooms that appear on Lake Mendota during the summer are a type of cyanoba… |
| 2942 | Use the table below solve this half-reaction problem. Look at these two half-reactions. Predict whic… |
| 2943 | I want to measure the bacterial population on a McDonald’s hamburger after an incubation perio… |
| 2944 | A major difference between irradiation and pasteurization is that...… |
| 2945 | What would be unique in a bacteria species that forms biofilms compared to a bacteria species t… |
| 2946 | How is the light-harvesting center in green bacteria different from the light-harvesting center in p… |
| 2947 | Which element found in all microbes is correctly paired with its use in the cell? … |
| 2951 | Which of the following choices is INCORRECT regarding anoxygenic photophosphorylation...… |
| 2953 | The following are true of substrate level phosphorylation and oxidative phosphorylation (select all … |
| 2955 | What mechanism is shared between Photosynthesis and Retianl-based Phototrophy? … |
| 2956 | In a hot spring, a microorganism that is a _________, has adapted to this environment by having ____… |
| 2957 | Which of the following is false regarding biofilms?… |
| 2960 | Which of the following is NOT a correct statement regarding anaerobes, aerobes, and micro-aerophiles… |
| 2961 | Which of the following is true regarding the difference between purple bacteria and cyanobacteria in… |
| 2962 | The cytochrome b/c<sub>1</sub> complex in the electron transport chain shuttles electrons with the h… |
| 2963 | You want to grow a culture of a specific type of microbe. This microbe is non-fastidious and you wan… |
| 2964 | An unidentified microbe is found to use light as an energy source. This microbe is also found to use… |
| 2965 | In order to adapt to its changing environment, what must a microbe do when temperatures rise and wat… |
| 2969 | When <em>E. coli</em> is deprived of nutrients, the activity of which protein would be expected to i… |
| 2970 | A bacterium with no electron transport chain relies on glucose for energy in an anaerobic environmen… |
| 2971 | Your research mentor has found a new microbe living in Lake Mendota. Not much is known about the mic… |
| 2974 | You are hoping to preserve some of your summer/fall harvests to use in the winter by canning. You pl… |
| 2976 | ATP synthesis occurs at the ___ complex of ATP synthase when the proton motive force becomes energiz… |
| 2983 | What is the growth rate for yeast with and without the presence of oxygen? Further, pick the answer … |
| 2984 | You are a manufacturer of numerous plastic products. In accordance with regulations, you a… |
| 2986 | You decide to carry out an experiment to see the growth curve of two different microorganisms (A and… |
| 2987 | ____________ radiation, in the form of ___________, can kill microbes by ___________.… |
| 2988 | Which of the following are classified as micronutrients of cells?… |
| 2990 | Select all of the following statements that are true about the light-harvesting centers in purple, g… |
| 2993 | Of the following common elements essential for microbial life, which is correctly matched with its u… |
| 2994 | The following reaction is taking place in a cell: A + B → C + D. What will happen to the r… |
| 2999 | Electron transport chains use energy from high energy electrons to pump protons across membranes. Wh… |
| 3002 | Which of the following is false about ATP synthase … |
| 3003 | A microbe lives at the bottom of the marina trench and uses chemicals as its energy source, the micr… |
| 3005 | Pick the correct comparison between sterilization and pasteurization . . .… |
| 3009 | Which of the following is TRUE of oxygenic photosynthetic bacteria?… |
| 3015 | Recently, your facility has had problems with eliminating endospore-forming bacteria on its med… |
| 3016 | If we have a reaction: A+B-->C+D, we have 1.0 mol of A, 1.0 mol of B, 1.0 mol of C, and 1.0 mol o… |
| 3017 | The antisense RNA in quorum sensing turns up the translation of some genes and turns down the transl… |
| 3018 | You decide to expose some bacteria in your microbiology lab to a UV lamp. Before you start, what typ… |
| 3020 | A strand of DNA has a mutation in which a T-T dimer has formed. What most likely caused this mutatio… |
| 3022 | Which of the following can be found on plasmids that are commercially available for research… |
| 3023 | <i>Peligabacter ubique</i> is (select all that apply)… |
| 3024 | Consider the symbiosis between the tubeworm and sulfur-oxidizing bacteria. Which of the following st… |
| 3025 | Looking only at a DNA sequence of bacteria, you can tell if horizontal gene transfer is present if</… |
| 3026 | Cellulosomes are useful in the degradation of cellulose because:… |
| 3028 | You mutate a strain of <em>Staphylococcus aureus </em>so that AgrC is not bound by AIP.&nb… |
| 3031 | What most accurately describes what happens when a plasmid, which has a Toxin-Antitoxin System, is l… |
| 3032 | What would happen if <em>Staphylococcus aureus </em>had a deleterious frameshift mutation in the gen… |
| 3033 | Why are cellusomes efficient cellulose degraders?… |
| 3037 | Which of the following comparisons between deep sea ocean vent and lake primary producers is correct… |
| 3040 | Which of the following mutations in the tryptophan operon will result in an “OFF” operon… |
| 3043 | A mutation that prevents the formation of the secondary structure of the <em>rpoH</em> gene wou… |
| 3044 | A DNA sequence appears to have undergone a frameshift mutation in which an adenosine was insert… |
| 3047 | If UV light damages the DNA, how would you repair it?… |
| 3048 | Which of the following is true about plasmids and chromosomes in bacteria?… |
| 3049 | You want to mutate a plant using CRISPR, your goal is to replace a known acid-producing gene with an… |
| 3050 | Match the microbe to its role in the Nitrogen cycle… |
| 3051 | Which of the following is a way that plasmids maintain themselves in a host cell?… |
| 3052 | Which of the following best describes the difference between a deep sea ocean vent and a lake? … |
| 3053 | There is a mutation in DnaJ that does not allow RpoH to bind properly. What may happen as an outcome… |
| 3055 | Which is of the repair system pairings is incorrect?… |
| 3056 | Which one if these is NOT a difference between chromosomes and plasmids?… |
| 3058 | A mutated microbe is placed on agar that contains an antibiotic and turns a dark blue color while al… |
| 3060 | Methylmonoxoygenase (MMO) catalyzes the conversion of methane to methanol coupled with a reduction o… |
| 3061 | Many anaerobic bacteria employ cellulosomes as an alternative mechanism of cellulose degradation. Wh… |
| 3062 | Which of the following is not a required component to clone a target gene?… |
| 3063 | A mutation in <em>E. coli</em> causes a malformation of the cyclic AMP receptor protein, making it n… |
| 3064 | When considering respiratory chains, which of the following are factors that are included in Fe oxid… |
| 3069 | A base pair mutation inactivates TrpE, which codes for anthranilate synthase. This would most likely… |
| 3072 | While undergoing DNA replication, a mutation occurs that causes a G to pair with a T. The cell reali… |
| 3073 | <em>Phanerochaete chrysosporium</em>, a white-rot fungus, is able to degrade lignin by…… |
| 3075 | What would happen if a tubeworm were exposed to a respiratory poison?… |
| 3078 | Given there are three incorrect bases on one strand of DNA, ATCCGA is now AGGGGA, and the DNA i… |
| 3079 | After a cyanobacterial bloom and crash, there can often be a localized die-off of fish populations, … |
| 3081 | A mutation in the <em>LuxR</em> gene in a certain strain of <em>V. fischeri</em> makes the orga… |
| 3082 | <i>Leptospirillum ferrooxidans </i>is a Gram-negative, spiral-shaped microbe. It oxidizes Fe<sup>2+<… |
| 3085 | Which of the following hold true for the genetic exchange from a donor to recipient cell within bact… |
| 3086 | How does water affect abandoned open mines and how is it potentially a source of pollution?… |
| 3092 | Which of the following is true when differentiating between a chromosome and a plasmid? … |
| 3093 | Which of the following is true about the difference between chromosomes and plasmids? … |
| 3094 | You are studying a strain of pathogenic <em>S. aureus</em> and isolate a mutant with a structur… |
| 3098 | Which of the following regarding the ocean’s chemistry is not true?</p> <p> </p> <p… |
| 3100 | Which of these microbes can perform photosynthesis under low light conditions and deeper depths of t… |
| 3102 | There is a mutation in the operator of the <em>lac</em> operon, preventing LacI (repressor) from bin… |
| 3103 | Denitrification often occurs under aerobic conditions… |
| 3105 | In an environment what determines whether sulfate reducers/methanogens-acetogens become the dominant… |
| 3106 | All of these are true regarding the detection of a pathogen in the body EXCEPT:… |
| 3107 | What is FALSE about flavonoids in the human body? … |
| 3108 | In methanogens the proton motive force is generated by… |
| 3109 | Chloe has the genetic disease cystic fibrosis. Because of this, she has had frequent infections in h… |
| 3110 | All of the following are correct about the pathogenesis of <em>Staphylococcus</em> EXCEPT: </p> … |
| 3111 | Which of the following is NOT used to treat HIV?<br /> … |
| 3112 | Which of the following are antigens that the body can react to in order to raise an immune response?… |
| 3113 | Which of the following is true of microbiota in the oral cavity? … |
| 3114 | If you removed all of the microbes typically found in the gut of a human and the gut of a cow so tha… |
| 3115 | All immune cells originate from bone marrow stem cells.… |
| 3116 | After ingesting a particle, a dendritic cell may migrate to the nearest ________ to present the anti… |
| 3117 | Which of the following can trigger the complement cascade? (select all that apply)… |
| 3118 | The activation of the complement system is detrimental to its target because the complement proteins… |
| 3119 | An epidemic of dancing flubitis has overtaken Madison. Victims get an overwhelming urge to perform t… |
| 3120 | Order the steps of infection… |
| 3122 | What is the role of CD8 cells in a cell-mediated immune response?… |
| 3125 | A(n) _________ pathogen can cause disease only in individuals that are compromised, while a(n) _____… |
| 3127 | Which of these are virulence factors for the Salmonella bacterium?… |
| 3129 | Imagine that almost all Americans get the COVID-19 vaccine. If a vaccine is 95% effective, will 5% o… |
| 3130 | Which disease is not infleunced by the imbalance of <em>A. muciniphila </em>in the human G… |
| 3131 | As I write this question the US has 14,769,353 cases of COVID-19 and 282,375 deaths. The US governme… |
| 3132 | Which of the following are potential strategies to combat the growing number of antibiotic-resistant… |
| 3134 | Ever since the pandemic began, you have tried to start eating healthy, and you decided to go vegan. … |
| 3137 | Which methods are effective ways to combat antibiotic resistance?… |
| 3139 | Cytotoxic T cells kill target cells by… |
| 3140 | Which of the following pathogens could illicit an immune response via endotoxin activity?… |
| 3142 | A syntrophy can be best described as:… |
| 3143 | Which of the following is NOT how physician John Snow dealt with the source of the Cholera… |
| 3145 | Select all that are true regarding T cell maturation and their tolerance mechanisms:… |
| 3146 | What are the notable differences between inflenza virus and SARS-CoV-2?… |
| 3147 | Match each of the steps of the inflammatory process with the correct sequential step in which t… |
| 3148 | Upon infection by a pathogen, which of the following organs would not be<em> directly</em> involved … |
| 3151 | Methanogens are necessary for the metabolism of <em>Syntrophomonas. </em>The syntrophic associa… |
| 3152 | Which of the following systems/structures in the human body plays a role in immunity? </p>… |
| 3157 | Your friend offered you this new magic pill that would make all your dreams come true. Oh no! The pi… |
| 3161 | All of the following are ways in which the COVID-19 epidemic could have been controlled better <stro… |
| 3163 | Which of the following descriptions describes the virulence factor(s) E. coli uses to compromise its… |
| 3164 | Select ALL the ways a disease can be transmitted from PERSON-TO-PERSON. … |
| 3165 | What is the role of a fomite in transmission of pathogens between humans?… |
| 3167 | The disease that is the main cause of infectious diarrhea contains tcdA and tcdB that damage cells b… |
| 3170 | What would be the most effective quarantine plan to follow after being exposed to a friend who teste… |
| 3171 | Number the immune response to a microbe in the order that they occur in the body. … |
| 3172 | A mutation is present in an <em>E. coli</em> cell that makes its T3SS protein overactive. What might… |
| 3173 | Antibiotics are an effective way of getting rid of bacteria. Since β-lactam antibiotics target cell … |
| 3175 | During T cell maturation…… |
| 3178 | Which of the following statements about the differences between humoral and cell mediated adaptive i… |
| 3179 | Evidence that vaccines work include?… |
| 3180 | Methanogens and acetogens are typically found together in the environment. When CO<sub>2</sub> and C… |
| 3181 | The most effective vaccine for SARS-CoV-2 should:… |
| 3183 | When defining disease, which of the following is true?… |
| 3184 | A female patient comes in with what seems to be an eye infection. You run a number of tests and disc… |
| 3185 | A teenager loses his balance while riding a bike and falls hard on the pavement. He realizes that he… |
| 3186 | How does the bacteria Spirochete, which causes Lymes disease, infect its host?… |
| 3187 | Which antibacterial drugs works by inhibiting the transfer of growing peptide chains and the in… |
| 3188 | Toxic megacolon caused by <em>Clostridium difficile </em>is the result of the expression of which to… |
| 3191 | You are an epidemiologist for Dane County and are trying to propose a method to stopping the spread … |
| 3192 | TCA and TCDB are exotoxins produced by <em>Clostridium difficile</em> that cause significant inflamm… |
| 3193 | Which of the following is the function of a Type III secretion system?… |
| 3194 | Why can Chlamydia cause persistent infections? Choose the best answer.… |
| 3196 | An outbreak of cholera is happening in Northern Wisconsin and epidemiologists are trying to find out… |
| 3200 | What determines whether methanogens or acetogens become the dominant consumer of hydrogen in an envi… |
| 3203 | A 27-year-old male who is moderately active and is overall healthy contracts enterohemorrhagic <em>E… |
| 3205 | The bar graph shows the incidence rate of a particular epidemic you are tracking. Based on this data… |
| 3208 | True or False: it is possible for microbes to live in phagocytes by inhibiting phagolysosome fo… |
| 3211 | Which of the following is true regarding the different types of immunity?… |
| 3214 | You are working as a doctor in a hospital and your newest patient has been describing how they have … |
| 3215 | Which of the following is true for a diet of meat, eggs, and shellfish that contains phosphatid… |
| 3216 | Which of the following is false about the complement mechanism to detect the presence of a pathogen?… |
| 3218 | Which of the following is not a molecular mechanism for antibiotic resistance? … |
| 3222 | Could a fecal transplant of the microbiome of a thin individual into an obese individual help them l… |
| 3223 | If B cells could only make plasma cells, what would happen next time you encountered the same infect… |
| 3227 | Between the early 2000s and 2010s, there was a significant decrease in the incidence of HPV. Th… |
| 3230 | If you transplanted microbes from someone who was vegan into your own gut, assuming you eat a balanc… |
| 3231 | Select all that are true about the structure of DNA and RNA… |
| 3232 | Which of the following lists the five steps of the viral life cycle in the correct order?… |
| 3237 | Comparing the viral structure and replication cycles of Qβ, T4, and λ which of the following an… |
| 3238 | According to the phylogenic tree below, which of the following groups are most closely related?</p> … |
| 3239 | Which of the following is a unique feature of Gram-positive bacterial cells?… |
| 3240 | What is a MAJOR difference between prokaryotes and eukaryotes in the process of translation?… |
| 3241 | In cyanobacteria, gas vesicles in the cytoplasm function to… |
| 3242 | You are viewing a Gram-negative bacterium. Which are you <strong>not</strong> likely to ob… |
| 3243 | RNA is <strong>not</strong> used for hereditary information because… |
| 3244 | Which of the following is false regarding archaea?… |
| 3245 | DNA is used for hereditary information and not RNA because...… |
| 3246 | Streptokinase can treat the following diseases (check all that apply):</p> <p> </p> <p>&n… |
| 3247 | A patient comes in complaining of an upset stomach after consuming dairy. What enzyme is their body … |
| 3248 | What is the process protease uses to break the peptide bonds within proteins called?… |
| 3249 | Nattokinase is useful for treating...… |
| 3250 | Keratinase is not found in… |
| 3251 | The most common source for xylanase production is...… |
| 3252 | The enzyme that further converts maltose transformed by amylases into glucose is?… |
| 3255 | Your friends want to have a big glucose factory, which he believes will help him make big money. You… |
| 3257 | What discoveries were made from wine and beer fermentation research?… |
| 3260 | What is the reaction that catalase catalyzes?… |
| 3261 | What effects would you see in a person with a missense mutation in the PKLR gene?… |
| 3262 | Trypsin is a useful treatment for</p> <p> </p> <p> … |
| 3264 | In the medical field trypsin is used with chymotrypsin to help... … |
| 3266 | Invertase is an enzyme that catalyzes the hydrolysis of sucrose into what two compounds?… |
| 3268 | Which enzymes help with the digestive process?… |
| 3269 | What is left when lactase breaks down lactose?… |
| 3271 | The mechanism of ATP synthase involves a… |
| 3272 | A bacterium that contains cytochrome oxidase is growing in a medium that contains glucose, calcium, … |
| 3273 | Which of the following correctly describes the role of chlorophyll and/or carotenoids in a reaction … |
| 3275 | Cyanobacteria utilize oxygenic photosynthesis; Heliobacteria utilize anoxygenic photosynthesis. What… |
| 3276 | You have a new bacterium that grows as long filaments that settle to the bottom of the growth vessel… |
| 3277 | Which of the following if false about carotenoids and chlorophyll?… |
| 3278 | Oxidative phosphorylation differs from substrate-level phosphorylation in that oxidative phosphoryla… |
| 3279 | A mutation causes the <em>rpoH</em> gene to not form a secondary structure, what phenotypic conseque… |
| 3281 | You are observing purple bacteria, which you know undergoes anoxygenic photosynthesis. Which of… |
| 3283 | A major difference between purple bacteria and green bacteria is… |
| 3284 | Given the chemical reaction below, which change would result in a decreased rate of reaction from re… |
| 3285 | A bacterium uses chemicals as its energy source, CO<sub>2 </sub>for its carbon source, and inorganic… |
| 3286 | For hundreds of years salting has been a method used to preserve foods. What is the BEST description… |
| 3288 | A student recently became interested in the fermentation processes behind many foods they enjoy. Whi… |
| 3290 | Which is the fastest indirect method to observe the growth of the culture?… |
| 3291 | Which of the following are differences of the metabolic role of microbes in humans versus ruminants?… |
| 3293 | Regarding Fred Griffith's experiments on transformation, which statement is <em><strong>false</s… |
| 3294 | What is the best way you can tell if a cell's DNA has gone through horizontal gene transfer?… |
| 3296 | Methanotrophs, heterotrophs, and autotrophs are microbes that play a role in the carbon cycle. Selec… |
| 3297 | The following is true about cellulosomes...… |
| 3298 | What are some possible outcomes from consuming a diet that is higher in phosphatidylcholine?… |
| 3299 | During replication, there was an incorrect pairing between one base pair on the parent strand with t… |
| 3300 | You are studying mutations and decide to hit a DNA strand with UV light. Yo… |
| 3301 | You observe a lake filled with lots of algae and murky water, indicating high biological activity oc… |
| 3304 | An important difference between B-lymphocytes and T-lymphocytes is… |
| 3305 | Which of the following are part of the innate immune system's way of fighting extracellular path… |
| 3308 | Phagocytes kill microorganisms using oxygen-dependent and oxygen-independent methods. Select all met… |
| 3309 | What in our skin helps create the barrier to microorganisms?… |
| 3310 | All of the following traits of skin help to create an ideal environment to act as a barrier against … |
| 3311 | Which of the following are virulence factors?… |
| 3312 | Which of the following water sanitation measures could've prevented, or at least minimized the i… |
| 3313 | Human papillomavirus is a sexually transmitted disease that… |
| 3315 | Which of the following are characteristics of Lyme disease?… |
| 3317 | Match the scientist(s) to the discovery they made… |
| 3318 | A scientist claims to have discovered a coccus-shaped bacterum that is 0.02 µm in diameter. In your … |
| 3319 | Food is impacted by microorganisms in that… |
| 3320 | In terms of size and complexity, which statement best summarizes the differences between a bacterial… |
| 3321 | A cell from any living organism will contain (check all that apply)… |
| 3322 | If you look at the following list, what one thing must every microbial cell have.… |
| 3323 | Pili, flagella, and fimbriae are all anchored in the… |
| 3324 | Capsules in bacteria are most often made of… |
| 3325 | You are examining the properties of a mannose transport protein. It has a binding protein that captu… |
| 3326 | Taq Polymerase is an extremely themostable _____., that was isolated from _____, The bacterium… |
| 3327 | The ribosome is… |
| 3330 | A unique property of peptidoglycan is:… |
| 3331 | A bacterial cell inhabiting an aquatic environment is able to float to the air-water interface and t… |
| 3332 | Rifampicin is a drug that inhibits bacterial RNA polymerase. Since it is also a prokaryote, rifampic… |
| 3333 | What is the protein structure surrounding the virus called:</p> <p><img alt="A diagrapm of a viru… |
| 3334 | If the CII protein of the &lamda; bacteriophage had a mutation that completely inactivates it, the λ… |
| 3335 | Below is a list of famous microbiologists. Match them to their correct description.… |
| 3337 | If the MreB protein became inactive, the cell would probably...… |
| 3338 | What mechanism does penicillin use to stop bacterial growth?… |
| 3339 | The RNA polymerase of Archaea is similar to that of Eukarya in that… |
| 3340 | In DNA replication the role of Primase is to… |
| 3341 | Here is a set of alignments for 16S rRNA.</p> <p> </p> <table class="table table-striped"… |
| 3342 | Which of the following is <strong>NOT</strong> true of the Archaeal outer layers?… |
| 3343 | Which of the following is true regarding Bacteria and Archaea?… |
| 3344 | Why are lysozymes successful in inhibiting bacteria all the time, but penicillin isn't? … |
| 3347 | Select the statement(s) that is/are true about this phylogenetic tree...</p> <p><img alt="A Phylo… |
| 3349 | Which of the following is TRUE regarding DNA and RNA functions?… |
| 3350 | A newly discovered bacteria, <em>Iwanabedonewith thistest,</em> was discovered buried ben… |
| 3352 | Choose the following TRUE statement that is CORRECTLY matched to the organism… |
| 3353 | Which of the following is NOT a cytoplasmic structure in Bacteria?… |
| 3355 | What is unique to the lytic cycle?… |
| 3356 | Which of the following is <strong>false</strong> about RNA polymerase:… |
| 3357 | By the marvels of modern technology and a lot of digging, you have discovered what could possibly be… |
| 3358 | In bacteria FTsZ would be useful for which of the following?… |
| 3359 | If penicillin is active in a bacteria cell, what is the outcome? … |
| 3361 | Name one <b>difference</b> between a bacterial cell and a eukaryotic cell… |
| 3362 | A main difference between transcription and translation in eukaryotes and bacteria is that… |
| 3363 | What is a major difference between Archaea and Bacteria?… |
| 3365 | Name one <strong>difference</strong> between a bacterial cell and a eukaryotic cell… |
| 3367 | A pathogenic microorganism is tested for Gram's stain and you find that the microorganism stains… |
| 3368 | <a>Termination of Protein Synthesis takes place at all of these codons except. </a></p> … |
| 3370 | All of the following are true about lysozyme or penicillin except:… |
| 3371 | A major difference between the Rho-independent and Rho-dependent termination processes in prokaryoti… |
| 3372 | The bacterial nucleoid is commonly found in the center of rod-shaped bacterium. What is the main pur… |
| 3373 | The slow changing portion of the 16S rRNA allows for … |
| 3374 | What best explains why DNA is more stable than RNA?… |
| 3376 | What would be a possible reason why RNA viruses are more error-prone?</p> <p> </p> <p><br… |
| 3378 | Which of the following does not exist in the bacterial cell envelope?… |
| 3380 | The host cell that a lambda phage is residing inside is actively growing. Which of the following det… |
| 3382 | <em>Staphylococcus aureus</em> is growing rapidly in an organism, which drug would be the best to st… |
| 3383 | Does a Gram-negative or Gram-positive cell have a thicker layer of peptidoglycan? Select the correct… |
| 3384 | Why would some bacteria swim north in the northern hemisphere of the earth and south in the southern… |
| 3386 | Which of the following are reasons why DNA sequences found in a specific plasmid would&nbs… |
| 3387 | In what way did Walter and Angelina Hesse contribute to the early development of microbiology?… |
| 3389 | What is the main/primary difference between a nucleus and a nucleoid?</p> <p> </p> <p>&nb… |
| 3391 | All of the following are located in a Nucleoid except...… |
| 3392 | Which of the following statements about agar is TRUE? … |
| 3393 | Match the classification of viral genomes to how it is converted to mRNA. … |
| 3394 | How do the T4 phage and lambda phage differ from each other? … |
| 3395 | A new microbe was recently discovered containing a cell membrane with lipid side-chains compose… |
| 3396 | How is Archaea translation similar to Eukarya translation? … |
| 3397 | Which of the following factors would tend to increase membrane fluidity?… |
| 3398 | Why was Edward Jenner ahead of his time?… |
| 3405 | Why are lysozymes and pencillin more effective at destroying Gram-positive bacteria cell walls … |
| 3407 | Eukaryotes and Archaea differ from bacteria in that they.… |
| 3409 | After the process of Gram staining, if the cell retains the purple color from the crystal violet dye… |
| 3410 | What is unique about the structure of archaea and how does this affect its function in the environme… |
| 3411 | In the structure of lipopolysaccharide, which of the following parts make up lipid A (toxic componen… |
| 3412 | Which of the following best describes how penicillin inhibits the synthesis of peptidoglycan in bact… |
| 3413 | By forming a mesh in bacterial cell walls, peptidoglycan successfully… |
| 3414 | Three new birds were found on an island. They seem to come from a common ancestor, but as scientists… |
| 3415 | What is the mechanism the prion employs to cause disease?… |
| 3416 | What did Angelina and Walter Hesse contribute to modern-day microbiology?… |
| 3417 | Which of the following properties do Archaea and Eukarya <strong>not</strong> have in common?… |
| 3423 | Which of the following is a similarity between rho-dependent and rho-independent termination?… |
| 3425 | Knowing that Eukarya, Archaea, and Bacteria share a common ancestor who gave rise to many shared cha… |
| 3426 | Which of the following statements about taxis is INCORRECT?… |
| 3428 | You are conducting an experiment studying an exceptionally rare disease that involves the … |
| 3431 | Why is peptidoglycan important to bacterial cells?… |
| 3432 | What is the main difference between bacterial cell walls and eukaryotic cell walls regarding peptido… |
| 3433 | Robert Hooke's work in <em>Micographia</em> was important to future scientific discoveries becau… |
| 3434 | How did Anton van Leewenhoek's work change the way we study organisms?… |
| 3436 | Which steps are part of the lysogenic cycle, but not part of the lytic cycle?… |
| 3437 | A difference in the promoters of archaea and the promoters of bacteria is… |
| 3438 | A major difference between bacteria cytoplasmic membrane and archaea cytoplasmic memb… |
| 3439 | All of the following are functions of inclusions <strong>EXCEPT</strong>:… |
| 3440 | Lipopolysaccharide (LPS) is located...<br /> … |
| 3441 | Which one of the following statements is FALSE about the characteristics and functions of all microb… |
| 3442 | How do Type I pili and Type IV pili differ?… |
| 3443 | Which was <strong>NOT</strong> one of the problems faced with using gelatin to grow cultures?… |
| 3444 | Bacteria and Eukarya are similar in that they: … |
| 3451 | Carl Woese was the first...… |
| 3452 | Which type of membrane is most resistant to acid and heat because of ether-linked lipids...… |
| 3453 | Which of the following is NOT a true example of structure dictating function?… |
| 3454 | If penicillin inhibits peptidoglycan synthesis in cells, which type of cell(s) would generally be af… |
| 3457 | All of the following properties are true of the agar that Walter and Angelina Hesse discovered excep… |
| 3458 | An unknown organism is discovered to contain genes that code for peptidoglycan. Which domain/phyla i… |
| 3460 | What feature of the 16S rRNA does NOT make it useful from a evolutionary standpoint?… |
| 3462 | What is the difference between a nucleoid in a bacteria cell, versus a nucleus in a eukaryotic cell?… |
| 3463 | The following are all reasons to support the importance of studying microorganisms in a medical… |
| 3465 | In a phylogenetic tree of the three domains: Bacteria, Archaea, and Eukarya, which of the following … |
| 3466 | Select the statement that correctly compares a bacterial cell vs. a eukaryotic cell. … |
| 3467 | How do bacterial cells and archaeal cells compare?… |
| 3468 | All of the following are true about evolutionary relatedness of organisms EXCEPT...… |
| 3470 | Which of the following is NOT true about the structure of Peptidoglycan? … |
| 3472 | Transcription in bacteria consists of all of the following except… |
| 3473 | Which of the following statements correctly differentiates between the promotors of bacter… |
| 3474 | In a laboratory setting, you isolate a protein complex from a reproductive process within a pro… |
| 3477 | Choose the correct statement regarding metabolism… |
| 3479 | A bacterium was found to undergo aerobic cellular respiration. In order to generate a proton gradien… |
| 3481 | A groundbreaking new bacteria species was found in Lake Mendota. As a researcher at the University o… |
| 3482 | A lactic acid bacterium (<em>Streptococcus gordonii</em>) in your mouth grows on sugars and produces… |
| 3483 | A major difference between homofermentation and heterodermentation in glucose fermentation is...?</p… |
| 3484 | What is the key difference between a defined medium and a complex medium?… |
| 3485 | You are starting a new fruit juice company with your cousin and want to check that there are no cont… |
| 3486 | Which of the following accurately describes the role/structure of the reaction center in photos… |
| 3488 | You discover a new photosynthetic bacterium and begin to characterize its electron transport chain. … |
| 3489 | You are a research scientist and you have just discovered a new species of bacterium. This organism … |
| 3490 | The below pathway is a metabolic reaction for the degradation of lactate to propionate and acetate c… |
| 3493 | Which of the following is true about the MinCDE and FtsZ system?… |
| 3495 | The Light Harvesting Center of a cyanobacteria is thought to have evolved and taken parts of both th… |
| 3496 | What is one key similarity between growth factors and trace elements?… |
| 3499 | A novel microorganism is found to express the enzyme superoxide dismutase. The new microbe could pot… |
| 3500 | How have microbes, categorized as thermophiles, adapted to living in the extremes of their envi… |
| 3503 | What role do purple bacteria play in the research of photosynthesis?… |
| 3504 | Which foods use lactic acid bacteria as a part of their fermentation process?… |
| 3506 | Calculate the growth rate of this sample bacteria between 11 AM and 3 PM using the data ta… |
| 3507 | Based on the data table below, calculate the growth rate of both organism X and organism Y. Which or… |
| 3509 | <em>Lactococcus lactis</em> is an aerotolerant anaerobe. It is grown in the same medium, but Culture… |
| 3512 | If a microorganism is in the presence of a predator, which of the following would <strong>not</stron… |
| 3513 | What components are reused in respiration of fats and sugars?… |
| 3514 | Which of the following statements is TRUE regarding cyanobacteria's response to environmental co… |
| 3515 | You are pickling some beets and want to eliminate any possible <em>E. coli</em> contamination during… |
| 3516 | All respiration systems that have been discovered so far involve which of the following (choose all … |
| 3517 | Which of the following is correctly paired with its definition?… |
| 3519 | A certain microbe requires the growth factor biotin. Which of the following statements can be reason… |
| 3520 | Which of the following groups of organisms are involved in chocolate fermentation (choose all that a… |
| 3521 | Your company wants to manufacture special colored Kim Chi for the winter holidays. Your boss suggest… |
| 3522 | β oxidation results in the production of acetyl-CoA and reduced electrons in the form of FADH and NA… |
| 3523 | Match the set of elements or molecules to their nutritional classification… |
| 3524 | You are trying to study the growth characteristics of a bacterium that grows only using filamentous … |
| 3525 | Which of the following fermentations does NOT result in the production of lactic acid?… |
| 3526 | A microorganism that lives in coral reefs, an oxygen abundant environment, but does not use oxygen i… |
| 3527 | During the fermentation progression of making Kimchi… |
| 3530 | You have successfully grown bacteria in the lab. However, you notice that the cells present wer… |
| 3531 | How do myxobacteria respond to nutrient deprivation?… |
| 3532 | Oh no! Your nephew spilled your microbial isolate from lab all over himself and the table. How would… |
| 3533 | Which type of cyanobacteria environmental response results in the fixation of nitrogen?… |
| 3534 | Classify each of the following as either a macronutrient, micronutrient, trace element or growth fac… |
| 3535 | A major difference between trace elements and growth factors is that… |
| 3541 | What is the major component that differentiates green bacteria from purple and cyanobacteria in… |
| 3542 | Your friend heard on Facebook that you could use the biocide glutaraldehyde to kill the coronavirus.… |
| 3543 | Carbon, Hydrogen, and Nitrogen are examples of <u> &nb… |
| 3546 | Where are acidophiles located?… |
| 3547 | Determine the drop in electron potential of the following reaction.</p> <p>2O<sub>2</sub>&nb… |
| 3549 | A photoautotrophic lithotroph… |
| 3550 | Which of the following components does <strong>not</strong> assist the reaction center in recei… |
| 3551 | What is the drop in electron potential of the following reaction?</p> <p>NO<sub>3</sub><sup>-</su… |
| 3553 | Certain temperature resistant microbes adapt to extremely low temperatures at the molecular level by… |
| 3555 | UH-OH! You're studying a newly discovered microbe but accidentally dried out the only sampl… |
| 3557 | Match the light-harvesting complex structures to the correct phototroph.… |
| 3562 | What physical agent would be best to remove/kill microbes that produce endospores?… |
| 3564 | Imagine that you are a singular cyanobacterium. There is not a lot of cyanobacteria in your area and… |
| 3571 | What makes Substrate-Level Phosphorylation (SLP) a unique part of fermentation?… |
| 3572 | Why are purple bacteria great model for research? </p> <p> </p> <ol> </ol> <p>&n… |
| 3574 | Below are two half reactions. Which way will the reaction go and what is its potential energy?<… |
| 3576 | Identify the true statement about retinal-based phototrophy vs the photosynthetic apparatus of purpl… |
| 3579 | How is retinal-based phototrophy different than the photosynthetic apparatus of purple bacteria?&nbs… |
| 3580 | Which of the following is not a function of carotenoids?… |
| 3589 | In alcohol fermentation, glucose is broken down into ethanol and CO<sub>2</sub> while energy in the … |
| 3590 | Say you are making a batch of chocolate that will be fully fermented after seven days. Which type of… |
| 3591 | Which of the following characteristics is correctly paired with the cells' method to approach nu… |
| 3594 | Which of the following will increase the rate of the reaction forward?… |
| 3597 | What differentiates homofermentation and heterofermentation?… |
| 3598 | What do heterocyst do for Cyanobacteria?… |
| 3600 | Which of the following is a component of light harvesting complexes that is unique to green bacteria… |
| 3603 | If you have removed pathogens from living tissue, you have performed… |
| 3608 | The major difference between photoautotrophic lithotrophs and chemoautotrophic lithotrophs is that&n… |
| 3610 | Which of the following physical agents would be used to extend the shelf life of farm-picked strawbe… |
| 3614 | What protein is used in retinal based phototrophy?… |
| 3615 | Which electron, carbon, and energy source do chemoheterotrophic organotrophs use?… |
| 3616 | What is the role of trace elements in the cell?… |
| 3619 | In which of the following conditions would you expect the formation of heterocysts?… |
| 3624 | Match the phase to the statement that best matches what might be happening at each point on the… |
| 3629 | What's an isolation technique to select for the desired metabolic capacity of a cell?… |
| 3630 | Imagine a mutant where the tryptophan codons in the leader peptide of the <em>trp</em> operon are re… |
| 3631 | AgrC of the <em>agr</em> operon of <em>Staphylococcus aureus</em> has a mutation that makes it alway… |
| 3634 | Proteins involved in the heat shock response fall into a number of categories. (Select all that are … |
| 3635 | In quorum sensing in <em>Staphylococcus</em><em> aureus</em>, once RNA III is made it affects the ex… |
| 3636 | Plasmids may maintain themselves by... (select all that are true)… |
| 3637 | Microbes in acid mines can obtain their carbon by... (select all that apply)… |
| 3638 | Prior research has demonstrated that various eukaryotes, such as fungi and protists, reside inside a… |
| 3639 | You isolated a novel thermophilic bacterium, <em>Bacillus badgerus,</em> using a selective minimal m… |
| 3640 | Based on what you know about the community physiology of microorganisms, which of the following stat… |
| 3645 | A major difference between cellulose degradation systems in aerobic and anaerobic bacteria is: </p> … |
| 3646 | You have the complete genome sequence of <em>Bacillus badgerus</em>. Your next goal is to find open … |
| 3647 | You have found four candidate β-glucanases in <em>Bacillus badgerus</em>. What is the most efficient… |
| 3648 | Horizontal gene transfer by conjugation can occur between different species.… |
| 3649 | Candidate mutants of <em>Bacillus badgerus</em> is grown up as isolated colonies on rich medium. It … |
| 3650 | Of the three methods of DNA sequencing we discussed, which one does not require the synthesis of DNA… |
| 3651 | Because of advances in culturing methods, it is now possible to bring most microorganisms present in… |
| 3652 | Is culturing microbes an effective way of learning what is in the environment? … |
| 3654 | The protozoa living in acid mines are… |
| 3655 | Why is the cell's lactose operon NOT induced in the presence of both glucose and lactose? … |
| 3659 | Choose the CORRECT regulation mechanisms involved in the heat shock response.… |
| 3662 | Which one of the following is used to classify a lake that is <strong>low </strong>in nutrient level… |
| 3663 | Which of the following options is a not characteristic/machinery of a soil environment?… |
| 3665 | Which season(s) does lake mixing occur and why - what is the consequences of this in regards to oxyg… |
| 3666 | An example of a chemoorganoheterotroph found in the deep ocean vent community is...… |
| 3667 | Which of the following is a correct sensor kinase/response regulator pair (and in that order)? … |
| 3668 | The thiamine mRNA transcript can have its expression altered by the binding of thiamine (a metabolit… |
| 3672 | A major difference between selection and screens is… |
| 3676 | Which one of the following phylotypes was <u><strong>NOT</strong></u> found in the <em>ocean</e… |
| 3677 | Your microbiology lab professor ask you to come up with ideas to mutagenize the cells for the experi… |
| 3678 | You are researching microbial communities in acid mine runoff. The specific type of microbes th… |
| 3679 | Which of the following statements is TRUE about denitrification?… |
| 3681 | When adenine binds to RNA to form the <em>ydhL</em> riboswitch this results in… |
| 3683 | The microorganisms in which group are the first colonizers in an acid mine and what integral early f… |
| 3690 | A major difference between transformation and conjugation is that … |
| 3692 | Tube worms have a symbiosis with which kind of microorganism?… |
| 3693 | <i>Leptospirillum</i> sp. are found in the acid mine. Select all of the following that are true.… |
| 3694 | You have been tasked with classifying a recently discovered lake. The water present is ver… |
| 3695 | The dominant bacterium in lake environments are from the ac1 lineage and the dominant bacterium from… |
| 3700 | Which of the following characteristics of microbes in mines contribute to the toxicity of acid … |
| 3703 | Ammonia-oxidizing bacteria, nitrite-oxidizing bacteria, and aerobic methane oxidation all share one … |
| 3705 | Which of these options is a correct difference between aerobic methane oxidation to anaerobic m… |
| 3706 | If there was a mutation in the <em>luxI</em> gene such that it was no longer functional, what would … |
| 3707 | A sample of soil microbes is being grown under anaerobic conditions and you have determined that the… |
| 3708 | The deep sea has been found to be home to multiple different microorganisms. <em>Geoglobus ahangari<… |
| 3709 | You have put a lot of work into purifying a cell culture of <em>Streptococcus pneumoniae</em>. To en… |
| 3710 | How do cells ensure that each daughter cell will get a plasmid?… |
| 3711 | Plasmids use a toxin-Antitoxin system, which is a linked gene that encodes for two proteins. If the … |
| 3712 | Which one of the physiology of acl-B1 is correct?… |
| 3713 | If a strain of <i>E. coli</i> had a mutated <em>lac</em> operon such that the LacI ge… |
| 3718 | What happens to the <em>lac</em> operon when lactose is <strong>NOT</strong> present and g… |
| 3724 | Why is culturing of microbes currently not an effective way of learning what is in an environment?… |
| 3727 | Which of the following is a selection?… |
| 3729 | Which statement is true regarding horizontal gene transfer via transformation?… |
| 3731 | What type of Eukaryotes grow and live in acid mines?… |
| 3732 | What is not a major group found to be present in acid mines?… |
| 3738 | Identify the correct paring between the lakes type and it’s corresponding nutrient level:… |
| 3741 | What is true about induction?… |
| 3744 | Which of the following is the most abundant primary producer in lakes?… |
| 3745 | A species of bacteria is able to freely take up DNA from its environment. Which of the following for… |
| 3746 | You have found two unknown microbes that behave identically in growth tests. However, other investig… |
| 3756 | A aberrant T cell that cannot be activated is isolated from a patient. Experiments performed on this… |
| 3757 | Select the correct statement regarding Koch's postulate:… |
| 3758 | What role do MAMPs play in the immune system?… |
| 3759 | A bacteriophage kills all the <em>Staphylococcus epidermidis</em> on your skin. The loss of this bac… |
| 3762 | <em>Danio rero</em> fish ( Zebrafish) have developmental abnormalities when raised in a germ-free st… |
| 3763 | What is a major difference between macrophages and neutrophils?… |
| 3764 | An activated cytotoxic T-cell (CD8+) recognizes a viral antigen in an MHC I molecule. The T-cell wil… |
| 3766 | What factors of gut microbiota promote weight loss?… |
| 3768 | You are a physician who has in-depth knowledge about the gastrointestinal tract. When looking at one… |
| 3769 | In hemorrhagic <em>E. coli</em> its virulence factors include… |
| 3770 | In the blood stage, this microbe attaches to, and then grows inside red blood cells.… |
| 3771 | The pandemic strain of influenza that hit the US in 2009 was caused by a mixing of bird, pig, and hu… |
| 3772 | Which of the following is not part of Koch's postulates? </p> <p> </p> <p> … |
| 3775 | Which of the following are steps in water processing? Check all that are correct.… |
| 3776 | You have a patient with bacterial pneumonia caused by Gram-positive cocci. Your first choice of anti… |
| 3777 | A new bacteria has the ability to kill any dendritic cells it encounters in its host. This will… |
| 3778 | Which of the following statements is TRUE regarding CD4+ and CD8+ T cells? … |
| 3784 | What is <strong>not true</strong> of rhinovirus infection?… |
| 3786 | Which of the following is not true about MHC I presentation?… |
| 3789 | Select the following statement that is NOT true about Rhinovirus:… |
| 3790 | If you think about reservoirs and carriers..… |
| 3792 | Which of the following is <strong>not</strong> an example of a role an opsonin can play?… |
| 3794 | Which of the following statements about skin as a barrier to infection is <strong>FALSE</strong>?… |
| 3795 | Which of the following statements about the differences between exotoxins and endotoxins is <strong>… |
| 3797 | What is the role of the bacterial symbiont in the Beewolf Digger wasps?… |
| 3798 | Which of the following is FALSE about <em>B. burgdorferi</em>?… |
| 3801 | Dysbiosis of the gut microbiota is believed to play a role in which of the following disorders:… |
| 3802 | Which of the following diseases are caused by viruses?… |
| 3803 | Key characteristics of CD4 and CD8 cells include:… |
| 3805 | Why would fusion inhibitors be an effective treatment for HIV?… |
| 3806 | The difference between probiotics and prebiotics is...… |
| 3807 | _____ is the type of antibody that makes up _______ of total antibody in serum. This antibody can ac… |
| 3808 | What is false about <em>C. difficile</em>?… |
| 3809 | Which of the following was <strong>NOT</strong> shown by the mouse diet experiment?… |
| 3811 | Which of the following regarding <em>Staphylococcus aureus</em> is false?… |
| 3815 | What is the activity/role that is specific to opsonins… |
| 3816 | Which of the following are associated with innate immunity … |
| 3817 | Which of the following diseases should you not treat with antibiotics due to the release of Shiga to… |
| 3818 | Match the microbial symbiont with correct the host and role.… |
| 3820 | Which of the following is not a way that microbes become resistant to antibiotics?… |
| 3822 | Which role is not typical of mutualistic microbes?… |
| 3823 | What is a difference between primary and secondary symbionts?… |
| 3825 | Which of the following describes the complement protein C3a? (Select all that apply)… |
| 3828 | What is some evidence that shows that each person has their own particular microbiota? Select all th… |
| 3829 | Which of the following is <strong>INCORRECT</strong>. Our body fights microbial infection by...… |
| 3830 | What step did John Snow NOT take to identify the source and end the Cholera outbreak in London? … |
| 3831 | Which of the following has helped decrease the transmission of disease?… |
| 3832 | Dendritic cells are present in the… |
| 3833 | What is <strong>not</strong> a function of dendritic cells?… |
| 3835 | What steps can individuals take to control the COVID-19 pandemic? (Check all that are correct)… |
| 3836 | Your friendly neighborhood dentist passes out baby carrots every year for halloween instead of candy… |
| 3839 | How does fermentation affect community physiology during anaerobic degradation?… |
| 3841 | Which is false about HPV?… |
| 3842 | What bacteria is inversely correlated with body mass and the severity of appendicitis? … |
| 3843 | Through various methods, microbes can become resistant to antibiotics. Select all of the following w… |
| 3845 | Which of the following environmental conditions would result in the highest efficiency of metab… |
| 3846 | Bacteria species A undergoes a normally unfavorable reaction in its metabolism, but bacteria species… |
| 3848 | Which type of vaccine injects a living pathogen and raises an immune response?… |
| 3851 | Acetogenesis will dominate in an environment...… |
| 3853 | Match the immune cell to one of its functions… |
| 3854 | Which of the following is an example of an exotoxin paired with the correct way it damages a host?… |
| 3855 | The difference between Methanogens and Acetogens is...… |
| 3856 | What are the benefits of <em>Staphylococcus epidermidis</em> on skin.… |
| 3857 | Which of the following is <strong>NOT</strong> true regarding the action of the toxins in <em>C. dif… |
| 3858 | Which of the following is a correct characteristic regarding the skin as a barrier to… |
| 3861 | Which of the following is NOT a reason why skin acts as a barrier to microorganisms?… |
| 3862 | What is the main difference between MHC I and MHC II?… |
| 3863 | How does the microbiome impact weight gain? </p> <p> </p> <p> </p> <p> … |
| 3864 | Which species of <em>Plasmodium</em> is the biggest problem to humans due to it having no prefe… |
| 3867 | Which of the following is <strong>NOT</strong> a characteristic of the acetyl-CoA pat… |
| 3869 | One week after taking a long hike through the woods you develop a fever, general malaise and no… |
| 3870 | Which of the following about flavonoids are true?… |
| 3871 | Which of the following did not decrease the incidence of infectious disease? … |
| 3872 | You discover a new microbe living in a hydrothermal vent. You shine a UV light on the slide containi… |
| 3873 | Which of the following is <strong>FALSE</strong> about <em>Staphylococcus epidermidis</em>?… |
| 3876 | In an anaerobic environment with low levels of CO<sub>2 </sub>and low levels of SO<sub>4</sub>,… |
| 3877 | Which of the following is <strong>false</strong> about flavonoids and the human microbiome? … |
| 3881 | What is the function of a type 3 secretion system?… |
| 3886 | Which of the following is not a factor that plays a role in antibody diversity?… |
| 3887 | What is a reservoir?… |
| 3890 | <br /> The enzymes Amylase employs water to breakdown which kind of molecular bonds?… |
| 3891 | Lactase is commonly used to alleviate symptoms of ... … |
| 3892 | The enzyme alpha-amylase is useful in breaking down which polysaccharide? … |
| 3894 | A research lab has developed a new antibiotic similar to penicillin. This antibiotic would be most e… |
| 3895 | When this enzyme has low activity in humans, cancer and cardiovascular diseases are likely to occur.… |
| 3896 | What bacteria do all cheeses being made rely on to finally make it to the form that everyone enjoys?… |
| 3897 | Streptokinase is a useful treatment for… |
| 3902 | Papain is found in...… |
| 3904 | Lipase can be used for… |
| 3905 | Which of the following prevents oxidative damage by regulating hydrogen peroxide at a cellular … |
| 3906 | In his TED talk, Rob Knight mentions that Cesarean, or C-section, births may lead to greater risk of… |
| 3907 | The ENS ... (select all that apply)… |
| 3908 | What is the main difference between ATP and NADH?… |
| 3910 | Which of the following would NOT be an example of fermentation?… |
| 3911 | A major difference between photophosphorylation and oxidative phosphorylation is:… |
| 3912 | An increase in entropy of a reaction results in...?… |
| 3915 | Which of the following uses a membrane and proton gradient to generate ATP, but does not have reacti… |
| 3916 | You are making a batch of cheese using a starter culture. You’ve noticed a lot of bubbles have forme… |
| 3918 | What starter culture is added to Kim chi (a vegetable food staple in Korea) in order for the ferment… |
| 3920 | Which of the following is not true of a physical agent used to control and limit microbial growth?… |
| 3921 | Which of the following is true about the role of cytochrome Oxidase in the electron transport chain?… |
| 3922 | What is the generation time of a microbe population if the population is 2x10<sup>7</sup> CFU/m… |
| 3924 | Which of the following explains why some organisms cannot survive in the presence of oxygen?… |
| 3926 | What is the most effective way to eliminate the greatest possible number of microbes?… |
| 3927 | How does nematophila bacterium help nematodes?… |
| 3928 | The fermentation progression of chocolate relies on multiple types of bacteria. Which statement accu… |
| 3930 | A microbe that uses organic compounds as a carbon source, organic chemicals as an electron source, a… |
| 3932 | In your research lab, you isolate an unknown bacteria. After performing some experiments, you f… |
| 3933 | Which molecule is oxidized in this redox reaction?</p> <p>C<sub>6</sub>H<sub>12</sub>O<sub>6</sub… |
| 3936 | Select all of the following that are true… |
| 3937 | Which outcome is most likely to occur when transplanting a HFD dieted mouse's microbiome into a … |
| 3941 | In general, the difference between the effect of high temperature above the growth range of a bacter… |
| 3944 | Which one of these is a macronutrient… |
| 3945 | What is the symbiotic relationship that Rhizobia has with its host?… |
| 3946 | What are aphid diets missing that the bacterium <em>Buchnera aphidicola </em>produces for them?… |
| 3947 | Which of the following is not the function of <em>Lactobacillus acidophilus</em> in its partner… |
| 3949 | Insect hosts of endosymbionts cannot survive if their endosymbiont is lost.… |
| 3950 | Zooxanthellae provides which essential components to Coral for photosynthesis?… |
| 3953 | Which of the following forms of regulation is not utilized by the<em> trp</em> operon?… |
| 3954 | For your research, your team travels to southern Minnesota where there is a lot of farmland. You fin… |
| 3955 | You have a bacterium, <em>Goldy dooficus, </em> that makes a toxin, BadG, which causes people to roo… |
| 3956 | Which is the correct classification of an oligotrophic lake?… |
| 3958 | What is the source of energy and the source of carbon for microbes that are living in acid mines?… |
| 3960 | Which of the following explains how lake mixing occurs?… |
| 3961 | Which of the following is <em>FALSE</em> regarding Quorum sensing in Gram-positive bacteria?… |
| 3962 | One of the primary differences between transduction and transformation is that...… |
| 3963 | One of the primary differences between a selection and a screen is that...… |
| 3967 | Which one of the following is False about two-component regulators?… |
| 3969 | Which of the following bacteria causes diarrhea?… |
| 3970 | The gut would appear to be one of the prime spots for microbe invasion and infection of our tissues … |
| 3971 | Which is not an example of Host-Microbe Interaction?… |
| 3972 | Which of the following are NOT the virulence factors the pathogen, <em>Borrelia Burgdorferi, </… |
| 3973 | While hiking on a near by trail, you notice some unique looking flowers just off the dirt path. You … |
| 3975 | Which of the following correctly identifies the chemoattractants for phagocytes as well as thei… |
| 3976 | Which of the following is an implication of the large genome of SARS-CoV-2?… |
| 3977 | One of the primary differences between the catabolic processes of methanogens, acetogens, and sulfat… |
| 3988 | What protein complex in the cytoskeleton is important for cell division?… |
| 3989 | Where are ribosomes found in prokaryotic versus eukaryotic cells?… |
| 3990 | Which of the following would you expect to find only in Gram-positive bacteria?… |
| 3991 | Which is NOT a correct description of molecular structures of lipids, LPS, amino acids, sugars and n… |
| 3993 | In a lysogenic infection… |
| 3994 | You monitor a Lytic Virus, you know it is a dsDNA virus and causes the cell to lyse at the… |
| 3995 | Which disease did Edward Jenner, a British doctor, successfully prevent, and what method did he use?… |
| 3997 | The characteristics that all cells share are… (choose all that are correct)… |
| 3998 | The use of ATP is unique to which transcription termination method?… |
| 3999 | What are the differences in cell wall composition between Archaea and Bacteria?… |
| 4000 | Which of the following answers are true for both Archaea and Eukarya RNA polymerase(s)? … |
| 4002 | What is a key feature of Archaea? … |
| 4003 | What bacterial lineage is responsible for the food production of cheeses, beer, kombucha, and more, … |
| 4004 | A possible reason for Woese settling on 16 S RNA for constructing phylogenetic trees could be b… |
| 4007 | What is the difference between active transport and facilitated diffusion? (Select all that are corr… |
| 4009 | Match the role of the microbe with its corresponding category of impact.… |
| 4012 | in Rho-independent termination present in bacteria, what causes the RNA polymerase to cease tra… |
| 4015 | What is the special problem of (-) single stranded RNA viruses?… |
| 4016 | A new organism is found in Lake Mendota. It seems to have the same structures as bacteria, but there… |
| 4019 | Which of the following letters represents the promoter of a prokaryotic gene?</p> <p> </p> … |
| 4022 | All cells have...… |
| 4026 | Which attribute would an accurate phylogenetic tree use to classify microbes… |
| 4028 | Number 4 in the figure shown below is pointing to...<img alt="A cartoon of a typical bacterial cell.… |
| 4031 | Which of the following structures are found in most Gram-positive and Gram-negative cells? (Select a… |
| 4032 | Inclusions, located in the cytoplasm, tend to be species specific and provide a variety of different… |
| 4034 | Microbes utilize pili structures to aid in movement. Which of the following is the correct matching … |
| 4035 | In France, there was souring of wine and many people did not understand why this was happening.… |
| 4036 | What is the correct order of a virus's life cycle?… |
| 4037 | What major scientific advancement did Walter and Angelina Hesse discover for the world of microbiolo… |
| 4040 | Lipopolysaccharide (LPS) is</p> <p> </p> <p> … |
| 4043 | Antony van Leeuwenhoek contributed to the field of microbiology due to his advancement of...… |
| 4046 | Which of the following do Bacteria and Eukarya NOT have in common?… |
| 4047 | Using the genetic code table, translate the given codon sequence of a gene into its corresponding am… |
| 4048 | Which of the following, if <strong>absent</strong>, would prevent the process of <strong>DNA transcr… |
| 4052 | Which of the following provides evidence for the endosymbiotic theory in eukarya? … |
| 4055 | Prions are pathogenic agents that can cause neurodegenerative disorders. What mechanism causes such … |
| 4057 | Properties of a Gram-Positive cell envelope include… |
| 4058 | If a cell’s Type IV pili are nonfunctional, which form of movement will the cell become unable… |
| 4061 | Which of the following characteristics is unique to <strong>only</strong> bacteria?… |
| 4062 | In bacteria, capsules and slime layers are best described as forms of...… |
| 4065 | Cell wall structures are different in Archaea vs. Bacteria. Which of the following examples are foun… |
| 4066 | If you take a naked ds DNA virus and move it into the cytoplasm of its host. It can often create vir… |
| 4067 | Molecular chaperones… |
| 4068 | Which of the following features is unique to each type of Bacteria/Archaea?… |
| 4069 | What makes carotenoids efficient in quenching triplet state chlorophyll?… |
| 4070 | Which is the most effective way to make a reaction proceed towards the products?… |
| 4071 | Which of the following are characteristics of chlorosomes?… |
| 4072 | Which is the most effective way to make a reaction proceed towards the products faster?… |
| 4075 | One way bacteria can avoid predation is by becoming filamentous; this prevents protists from consumi… |
| 4077 | Fermentation is…… |
| 4078 | Recently at your brewery, beer batches have been failing. Analysis shows that your beer has an alcoh… |
| 4079 | β-oxidation catabolizes _____________ prouducing ____________ and ____________… |
| 4080 | Light-harvesting complexes (LHC) focus collected photons onto… |
| 4081 | If you compare the electron transport chains of green bacteria, purple bacteria, and cyanobacteria t… |
| 4082 | A researcher is studying the growth rate of a bacterial culture. If the researcher wanted to c… |
| 4083 | <em>Lactococcus lactis</em> requires guanine to be present in any medium for it to be able to grow. … |
| 4084 | You are studying a bacterium that grows by filamentous growth and creates a biofilm in the bottom of… |
| 4085 | What does the food industry NOT do to chemically control microbes?… |
| 4086 | When <em>E. coli</em> begins to starve for nutrients it will.… |
| 4087 | Biocides are different than antibiotics because they generally damage DNA and proteins, while antibi… |
| 4092 | You decide to ferment beer and accidentally added double the starting amount of sugar in y… |
| 4093 | Match the method used to control microbial growth to its defining feature.… |
| 4094 | A newly discovered bacterium is isolated and grown in both aerobic and anaerobic conditions. The str… |
| 4095 | You have created a non-heat-sensitive medium, but you think one of you lab partners has contaminated… |
| 4096 | When comparing the TCA cycle and Beta-Oxidation, which of the following is a difference between the … |
| 4097 | Which of the following events does NOT occur during retinal-based phototrophy?… |
| 4099 | What distinguishes the light harvesting complex of the purple bacteria compared to the gre… |
| 4100 | Which of the following proteins is involved in guiding FtsZ to identify the center of… |
| 4101 | Which of the following will provide an accurate measurement of only live cells?… |
| 4102 | Which of the following is NOT a way for chemical biocides to kill microorganisms?… |
| 4105 | <em>Flectobacillus</em> spp. uses morphological plasticity to survive against its predator <em>… |
| 4106 | You brewed a batch of beer yesterday, but when you poured yourself a glass you noticed it tasted sou… |
| 4107 | How does ATP Synthase generate ATP using a proton gradient?… |
| 4110 | Which of these options correctly classifies the nutrient and identifies its function?… |
| 4111 | Trace elements in the cell can best be described as… |
| 4112 | Biocides are used in many different industries to nonspecifically target and remove organisms. They … |
| 4113 | A microorganism is trying to avoid being killed by a predator. Which of the following could be used … |
| 4114 | In this order: energy, carbon, and electron. What are a photoautotrophic lithotrophs sourc… |
| 4116 | Which of the following is a difference between anaerobic respiration and aerobic respiration?… |
| 4117 | A new microbe was discovered in a research lab at UW Madison. The researchers found that the microbe… |
| 4119 | Homofermentation and Heterofermentation are two distinct processes of fermentation that bacteria use… |
| 4122 | Retinal-based phototrophy is dependent on?… |
| 4123 | Why are trace elements important if we do not need a large amount of them?… |
| 4125 | Why is ATP used to phosphorylate glucose at the start of EMP glycolysis, and is it substrate-le… |
| 4126 | When comparing the photosystems of green bacteria, purple bacteria and cyanobacteria what are some c… |
| 4127 | Nutrient starvation can cause microbes to react in which of the following ways.… |
| 4128 | Match the situation with the method for controlling bacterial growth.… |
| 4129 | Match the tier of elements to their real-life example based on abundance, source, and ability to be … |
| 4130 | Which of the following is NOT a redox reaction?… |
| 4131 | Which of the following are ways microbes may react to starvation?… |
| 4132 | A speciailzed pair of chlorophylls exists at the reaction center. What is the key element present in… |
| 4133 | What functions does the membrane serve in the electron transport chain?… |
| 4134 | Hibernation is a response to starvation in some cells that sense change during entry to th… |
| 4136 | Within the cell membrane, there is a chain of electron carriers: one that reduces cytochrome c (254 … |
| 4137 | What is positioned next to the pair of chlorophylls in the reaction center in order to react with ch… |
| 4139 | How do biocides affect microogranisms?… |
| 4140 | What does <em>E. coli </em>do when they sense impending nutrient limitation? … |
| 4142 | In what order do microbes promote the fermentation of Kimchi? (first to last)… |
| 4145 | Which of the following are electron carriers? (select all that apply)… |
| 4146 | An organism grows anaerobically, uses light as its energy source, carbon monoxide as its carbon sour… |
| 4149 | Which of the following is true of catabolic pathways?… |
| 4152 | Possible roles of carotenoids are to...</p> <p> </p> <p> … |
| 4154 | Which of the following is correct about the difference between homofermentation and heteroferme… |
| 4155 | One major difference between purple and green bacteria is:… |
| 4157 | What phase(s) on a bacterial growth curve is/are used in the calculation of the growth rate?… |
| 4158 | Aerobic and Anaerobic respiration are categorized by whether or not they use oxygen or some other mo… |
| 4159 | Which of the following would increase the favorability of a reaction? (select all that are correct)… |
| 4160 | Biocides kill micro-organisms by … |
| 4162 | Which feature of the photosynthetic process does NOT distinguish the cyanobacteria from&nb… |
| 4163 | To prepare fruit for shipping it is common practice to use....… |
| 4167 | Which of the following statements are true about starvation reactions? … |
| 4170 | Which of the following are functions of magnesium?… |
| 4171 | In this redox reaction, what is change in electron potential?</p> <p>2H2+O2 -> 2H2O</p> <p>… |
| 4174 | What might cause of the accumulation of acetaldehyde during the process of beer fermentation?… |
| 4176 | The bacterial cell uses succinate as it’s carbon and electron source. It also uses light as it… |
| 4177 | A small molecule binds to a repressor, activates it, and ultimately stops transcription. What is the… |
| 4178 | The <em>trp</em> operon is regulated by a number of different mechanisms of regulation. These mechan… |
| 4179 | Which of the following is a difference between the cell’s response under heat shock versus und… |
| 4180 | The main difference between a chromosome and a plasmid is… |
| 4181 | When adenine is not present in the riboswitch for the ydhl gene, what happens?… |
| 4182 | Match the RNA regulation concepts to their correct definitions. … |
| 4186 | You mutate a culture of <em>E. coli</em> such that it expresses resistance to rifampicin. Which of t… |
| 4187 | Why is manual culturing of microbes NOT an effective way of understanding what is in an environment?… |
| 4190 | The genes of the <em>lac</em> operon encode proteins needed for lactose metabolism in <em>E. coli</e… |
| 4191 | A deletion mutation of the <em>trp</em> operon repressor (trpR) would… |
| 4194 | Why was it difficult to isolate <em>Pelagibacter unique</em>?… |
| 4196 | Bacteriorhodopsin undergoes a conformational change within the membrane to:… |
| 4198 | What are the major products under anaerobic conditions with no SO<sub>4</sub>?… |
| 4199 | What happens when the auto-inducing peptide (AIP) concentration is high outside the cell and the cel… |
| 4200 | <em>Vibrio fischeri</em> is a species of bacteria that is capable of bioluminescence. Quorum sensing… |
| 4202 | Prochlorococcus is a cyanobacteria that is able to grow in oligotrophic regions at low light and dee… |
| 4203 | Match the various parts the the CRISPR Cas9 system to its proper function for editing a gene.… |
| 4205 | The maltose operon is regulated by the maltose activator protein, MaIT. Why is this protein required… |
| 4207 | What is the key difference between the degradation of cellulose in aerobic conditions versus anaerob… |
| 4208 | A strain of bacteria is mutagenized in hopes of producing higher levels of vitamin B12, the culture … |
| 4209 | If an intercalating dye mutagen is present within a strand of DNA that causes the insertion of an ex… |
| 4210 | What is the proposed metabolic physiology of ac1-B1?… |
| 4211 | What differentiates <em>Geoglobus ahangari </em>and <em>Thermococcus atlanticus</em> species found i… |
| 4212 | Which of the following accurately describes Sanger Sequencing?… |
| 4214 | Lake Mendota can be described as a Eutrophic lake. Which of the following best describes an Eutrophi… |
| 4220 | What characteristics does an oligotrophic lake have?… |
| 4221 | Your friend tells you that the lake next to your house is oligotrophic. You know that it is an oligo… |
| 4226 | Which of the following correctly describes <em>Geoglobus ahangari</em>, a deep sea ocean vent microb… |
| 4228 | Which process best describes how biopolymers are degraded<u><strong> anerobically</strong></u>? … |
| 4230 | Some soil organisms are able to break down complex bio-polymers such as lignin. How is lignin degrad… |
| 4231 | How does the synthesis of the leader peptide affect the regulation of Trp?… |
| 4233 | Which of the following best describes the CRISPR Cas9 system and its use in gene editing?… |
| 4236 | You want to get a detailed survey of the microbes and their genetic information within a soil sample… |
| 4245 | What is the most common species of <strong>Archaea</strong> found in acid mines? … |
| 4247 | Which of the following is NOT a characteristic of both Prochlorococcus and Synechococcus?… |
| 4249 | In attenuation in the<i> trp</i> operon when Trp is in excess: … |
| 4253 | Which of the following regulation mechanisms does the <em>trp </em>operon not utilize?… |
| 4254 | LacI is a _____ regulator, while CAP is a _____ regulator.… |
| 4256 | Lignin is a polymer that is reduced to phenolics by . . .… |
| 4258 | Which of the following biopolymers would be most beneficial for the growth of ac1-B1?… |
| 4259 | In what environment do <em>Pelogibacter ubique</em> grow and what is a specific requirement for this… |
| 4265 | You are trying to identify if a specific foodborne pathogen is present in food in a quick and effect… |
| 4266 | Where do the primary producers in acid mines mostly obtain their carbon source from?… |
| 4267 | Eukaryotes found in acid mines… |
| 4271 | Which is/are true if there is a high cell population of <em>Vibrio fischeri</em>?… |
| 4279 | Why do so many deep sea organisms use inorganic materials for metabolism?… |
| 4284 | There is an environment with little sulfate in it. What is the most likely product of the anaer… |
| 4285 | Match the immune cell to the correct description.… |
| 4286 | Which cytokine is correctly matched with its effect during the innate response?… |
| 4287 | Rhinovirus…… |
| 4288 | Which of the following answer choices correctly describes the relationship between phylotypes and a … |
| 4289 | A newly discovered pathogen is able to survive prolonged periods on physical objects and then transm… |
| 4291 | Hydrogenotrophic methanogens reduce _______ into _____ and ______ to carry out methanogenesis.… |
| 4293 | Which of the following diseases is transmitted by airborne droplets?… |
| 4294 | Your elderly patient at the nursing home has contracted <strong><em>C. difficile</em></strong>.… |
| 4299 | Microbes tend to have a symbiosis with other microbial species in which the products of one reaction… |
| 4300 | Which is a true statement about the mechanisms of Prions?… |
| 4305 | Which of the following cannot be reduced to methane in methanogenesis?… |
| 4306 | You are investigating the gut microbiome composition in patients with different inflammatory bowel d… |
| 4307 | A major difference between B-cells and T-cells is that...… |
| 4308 | Suppose you wanted to vaccinate a population against a certain infectious disease, but some of your … |
| 4309 | If an individual does not have an ACE2 receptor they are unable to get infected by which pathogen?… |
| 4310 | Which of the following reasons explains why beta-lactam antibiotics do not work against <em>Myc… |
| 4312 | Which of the following accurately describes the process of methanogenesis?… |
| 4314 | Which of these is not something selected against during B-cell and T-cell maturation.… |
| 4317 | Which one of these is a reason that the skin is an effective barrier to microorganisms?… |
| 4318 | E. coli pathogens…… |
| 4321 | Which of the following accurately describes how T-cells sense that a host cell is infected?… |
| 4322 | <em>Syntrophomonas</em> oxidizes butyrate to acetate to make ATP. This process has a ΔG° of +48.… |
| 4323 | As demonstrated by participants in the biggest loser reality TV show, keeping weight off is difficul… |
| 4324 | Examples of major phagocytic cells in the body include:… |
| 4326 | How is the MHC I antigen-presenting pathway different than the MHC II antigen-presenting pathway for… |
| 4328 | How has the incidence of disease been reduced?… |
| 4329 | Which of the following answers correctly corresponds to each type of toxin?… |
| 4331 | What does Azithromycin target?… |
| 4332 | The unique characteristic of Amensalism is:… |
| 4333 | What is the difference between the foregut chamber and the hindgut chamber within mammals that canno… |
| 4335 | What is a major difference between B cells and T cells?</p> <p> </p> <p> … |
| 4336 | John Snow investigated the outbreak of which disease in 1854, ultimately discovering that it was bei… |
| 4340 | Safe drinking water must have pathogens and other contaminants removed from it. The steps for this t… |
| 4341 | You are a super amazing scientist that just isolated new pathogen <em>Almostdone withfinals.</em><i>… |
| 4343 | What is the order of Koch's postulates? Rank them 1-4 with 1 being the first.… |
| 4346 | Zebra fish in a bacteria filled environment differ from zebra fish in a germ free environment b… |
| 4347 | What is the difference between macrophages' and dendritic cells' roles in antigen presentati… |
| 4348 | Match the antimicrobial secretion to its correct mode of action. … |
| 4350 | What is a true statement about Rhinoviruses?… |
| 4351 | The difference in mechanism between two common antimicrobial glycoproteins, transferrin and fib… |
| 4352 | What are some possible ways that microbes make themselves resistant to antibiotics? (select all that… |
| 4355 | Match the antimicrobial defense substance with the correct mode of action … |
| 4358 | Which of the following statements is correct regarding Koch’s postulate?… |
| 4359 | How are T cells activated? … |
| 4360 | A complement activation pathway involves binding to a carbohydrate on a pathogen's surface via a… |
| 4361 | How does a component vaccine raise an effective immune response in order to protect people from dise… |
| 4363 | Which of the following are steps involved in the activation of B lymphocytes?… |
| 4368 | Endotoxins…… |
| 4370 | How did John Snow determine the cause of the London Cholera outbreak?… |
| 4373 | Methanogenesis is the process of reducing compounds to methane, with hydrogen often being the electr… |
| 4374 | Lipopolysaccharides on the outer membrane of Gram-negative bacteria can act as an endotoxin. How do … |
| 4375 | If a eukaryotic cell is capable of photosynthesis, it must have a…… |
| 4376 | You isolate an bacterium growing in Mammoth Hot Springs at Yellowstone National Park. <img alt="Mam… |
| 4377 | A cell growing in a lake senses the nitrogen and phosphate concentrations decreasing, and it begins … |
| 4380 | Glucose Oxidase converts glucose into_____… |
| 4384 | Nisin is <strong>not</strong> present in which product/s?… |
| 4385 | When alcohol dehydrogenase comes into contact with alcohol, what intermittent product is metabolized… |
| 4389 | Glucose Isomerase can be used to create a reaction producing which of the following… |
| 4390 | When enzyme helps digest fats in our stomachs?… |
| 4391 | Rennet is most commonly used to make..... … |
| 4393 | What type of cancer is asparaginase used to help treat?… |
| 4394 | Which of the following is not an end product of heterofermentation?… |
| 4395 | Lactase is a useful treatment for...… |
| 4396 | A woman comes in complaining about her digestive issues. She is eating a lot more protein due to tra… |
| 4397 | Abnormally high lipase levels are associated with… |
| 4403 | <em>This</em> is a key enzyme found in Rennet. When <em>this</em> is introduced to casein proteins f… |
| 4409 | Cheese production is a process of complex milk fermentation. Which of the following steps is NOT a p… |
| 4410 | Nattokinase is currently undergoing further clinical trials to treat… |
| 4416 | Which LAB pathway results in the production of lactic acid, ethanol, and carbon dioxide?… |
| 4417 | DnaK, GrpE, and DnaJ are…… |
| 4418 | The toxin-antitoxin system for plasmid maintenance involves… |
| 4419 | Bacteria have CRISPR systems to… |
| 4420 | When scientists first started investigating the environment by trying to culture bacteria, they foun… |
| 4421 | Quorum sensing in <em>Staphylococcus aureus</em> uses a two-component system to translate the concen… |
| 4422 | The primary colonizers of the teeth are:… |
| 4423 | A huge collection of microorganisms populates your gut. While they have many uses, your body still n… |
| 4424 | Obese individuals have a different Bacteroidetes to Firmicutes ratio and a lower Shannon Diversity I… |
| 4425 | How do the Protozoa microbes assist termites?… |
| 4426 | Can termites survive without Protoza microbes?</p> <p> … |
| 4427 | What are mycelial threads?… |
| 4428 | What fungus do the roots of plants often form a relationship with?… |
| 4430 | Approximately how many microorganisms are living in the human intestines?… |
| 4432 | In the relationship between <em>Riftia Pachyptila</em> and <em>Gammaproteobacteria</em>, what d… |
| 4433 | What does <em>Mycorrhizae</em> collect from its host plant?… |
| 4434 | What do sulfer-oxiding bacteria provide for their host, the deep sea tubeworm? … |
| 4437 | How many living microorganisms live in your intestines? … |
| 4438 | Breastfeeding can help reduce the risk of... … |
| 4439 | What kinds of threats are presented to the <em>Lagria villosa</em> Beetle's eggs?… |
| 4440 | How does the bacterium <em>Burkholderia gladioli</em> help the <em>Lagria villosa</em> Bee… |
| 4441 | <em>Mycorrhizae </em>protect plants from soil-borne diseases.… |
| 4443 | The cell membrane linkage types of archaea, eukaryotes, and bacteria are as the following:… |
| 4444 | In a bacterial cell that can no longer synthesize <!--anki--><meta charset="utf-8" />N-acetylmuramic… |
| 4447 | Which statements are traits of a lysogenic cell infection by λ bacteriophage?… |
| 4453 | What is an example of why Archaea and Eukarya are considered sister groups (more related), whil… |
| 4456 | Which of the following is true about Bacteria, Archaea, and Eukarya?… |
| 4457 | A major difference between saturated fatty acids (SFA) and unsaturated fatty acids (UFA) is that&hel… |
| 4459 | What types of cells contain diaminopimelic acid (DAP)?… |
| 4460 | What is a major difference between bacteriophage lambda virus and T4 virus?… |
| 4462 | If you think about the life cycle of a virus...… |
| 4463 | How do (-) ssRNA viruses replicate their genes in the host cells?… |
| 4464 | Which of the following is true about peptidoglycan?</p> <p> </p> <p> … |
| 4465 | Which of the following accurately describes the differences between a bacterial cell and a eukaryoti… |
| 4466 | Why might it be beneficial for a species of pathogenic bacteria to have a capsule?… |
| 4467 | Which of the following is a similarity between archaeal cells and eukaryotic cells?… |
| 4468 | What is one structural or molecular similarity that Eukarya and Archaea share that differs from… |
| 4470 | Which of the following is a characteristic of the RNA polymerase in both Bacteria and Archaea that i… |
| 4472 | A major difference between rho-dependent and rho-independent termination is that... … |
| 4475 | What determines if Bacteriophage λ is lytic rather than lysogenic?… |
| 4477 | How does peptidoglycan differ in Gram-negative and Gram-positive bacteria?… |
| 4480 | Traditional phylogenic classification methods classify organisms based on similar characteristics, l… |
| 4481 | Microbes have a large biological impact on our planet, and their uses can be applied to many differe… |
| 4484 | Which of the following contain the correct scientist with their accomplishment?… |
| 4485 | You've come down with a bacterial infection days before your microbiology exam. Your doctor prec… |
| 4486 | Using the 5 RNA sequences provided, align the 6th listed sequence properly.</p> <p> </p> … |
| 4487 | Based on what characteristics are shared by extant species, which of the following characteristics d… |
| 4490 | At which point in it's life cycle does the Lambda Phage choose between lytic or lysogenic?… |
| 4494 | Which of the following is a major difference between rho-independent and rho-dependent termination?<… |
| 4495 | Given the options below, what makes the most sense for the function of the capsule in <em>Strep… |
| 4496 | Which option accurately explains the difference between how lysozyme and penicillin behave in the ce… |
| 4497 | Which of the following are characteristics of the viruses Qβ, T4, and lambda phage?</p> <p>&… |
| 4498 | Which of the following are characteristics of the viruses Qβ, T4, and lambda phage?</p> <p> … |
| 4499 | In bacterial transcription, the recognition of genes by RNA polymerase involves several key elements… |
| 4500 | What is a difference that separates Eukarya from Bacteria?… |
| 4502 | What is the difference between transcription promoters in bacteria and eukarya? … |
| 4503 | Which of the following is a major difference between the actions of lysozyme and penicillin on the c… |
| 4505 | What is a key difference between RNA and DNA?… |
| 4506 | Match the activity with its correlating step of the virus life cycle… |
| 4508 | <table border="1" cellpadding="1" cellspacing="1"> <tbody> <tr> <td>1</td> <td>G</td> … |
| 4509 | Molecular chaperones in protein synthesis...… |
| 4511 | When comparing Archaeal and Bacterial cell membranes, which of the following is true?… |
| 4516 | Which of the following is NOT found in a Gram-positive cell wall?… |
| 4517 | Robert Hook’s work involving microbiology was innovative for its time because … |
| 4520 | Angela and Walter Hesse discovered Agar as being helpful as a culture medium in the microbiology lab… |
| 4523 | What is the main difference between RNA viruses and DNA viruses?… |
| 4527 | Which protein is involved in bacterial cell shape?… |
| 4528 | What do Qbeta and T4 viruses have in common?… |
| 4530 | Phylogenetic trees are used in microbiology to infer relatedness and evolutionary background of micr… |
| 4538 | One major difference between Gram-positive and Gram-negative cells is: … |
| 4539 | You notice bubbling coming from the bottom sediment of a pond. You decide to try and light it with a… |
| 4541 | Why is it important that we study microbes (select all that apply)… |
| 4543 | In a triplet condon TAC, if it is accidentally mutated to TAA, what would happen to the protein sequ… |
| 4547 | Which of the following statements accurately describes a difference in the compositions of cell memb… |
| 4548 | Penicillin is often used as a way to destroy/inhibit peptidoglycan in the cell walls of bacteria. Th… |
| 4549 | What differentiates archaeal lipid side chains from bacterial and eukaryotoic lipid side chains?… |
| 4550 | Why do (-)ssRNA viruses carry replication proteins with them in the capsule and (+)ssRNA not?… |
| 4555 | Which cellular component is unique to bacteria and what is its function in bacterial cells?… |
| 4559 | Which of the following exists in both archaea and eukarya but not in bacteria?… |
| 4560 | A major difference between Rho-independent and Rho-dependent termination is that … |
| 4561 | Suppose an <em>E. coli</em> strain had a mutation that resulted in its flagella being unable to rota… |
| 4567 | What in Gram-negative bacteria causes the outer membrane to allow many molecules through?</p> <p>… |
| 4569 | Identify which of the following statements about evolutionary relatedness of organisms based on phyl… |
| 4571 | Gas vesicles are _______________ and function to ______________.… |
| 4573 | When considering peptidoglycan in Gram-negative bacteria...… |
| 4574 | What evidence would support the idea that mitochondria evolved from bacteria? … |
| 4577 | Upon drawing a depiction of a bacteria and eukaryotic cell, what must be included within both t… |
| 4578 | Which of the following are true about the structure of eukaryotic and bacterial cells?&nbs… |
| 4581 | The main structural difference between naked viruses and enveloped viruses is that… |
| 4582 | You discover a new virus and find that it carries the enzyme reverse transcriptase. What assumptions… |
| 4584 | How does horizontal gene transfer relate to the value of 16S rRNA in comparing evolutionar… |
| 4587 | Which of the following are traits of BOTH photosynthesis in purple bacteria and retinal-based p… |
| 4588 | Biocides work to control harmful substances by…… |
| 4590 | Which of the following best describes aerobic respiration?… |
| 4591 | What group of bacteria creates a chlorosome and what does it do?… |
| 4592 | The reaction center of a specific cell is missing the magnesium ion in the special pair of… |
| 4593 | Which of the following is a difference between anaerobic respiration and aerobic respiration?… |
| 4594 | What is the one of the ways that a proton gradient is created by cytochrome aa3 or electron carriers… |
| 4595 | Why are light harvesting complexes an important part of the process of photosynthesis? (Select all t… |
| 4596 | In chocolate, varying microbes are responsible for fermentation across the week-long process. Which … |
| 4597 | In Microbio 304, Microbiology of Organisms Laboratory, you are completing dilutions of an unknown wi… |
| 4598 | The cheese-making process relies upon which of the following?… |
| 4600 | You want to create a beer with a certain alcoholic percentage. But, when you are performing the stan… |
| 4601 | Which of the following bacteria are able to produce phycobilisomes?… |
| 4603 | Which of the following is true regarding light harvesting complexes?… |
| 4604 | Which of the following nutritional classifications match their corresponding definition?… |
| 4606 | MinE is absent in a cell. What is a plausible result of this?… |
| 4607 | If a microorganism has a cytoplasm with a pH of 10, we can conclude…… |
| 4608 | Given these two half reactions, which of the following is true?</p> <p>O2 + 4H+ + 4e- → 2H2O… |
| 4610 | Which of the following classifications of elements and molecules are correct? Select all that a… |
| 4612 | Chemical biocides are used in the oil/gas industry, specifically petroleum. Biocides help kill micro… |
| 4616 | You are given 2 readings from the log phase of a growth curve of "A" bacteria; the lower C… |
| 4619 | Which of the following is true about retinal-based phototrophy and the photosynthetic apparatus of p… |
| 4620 | Which of the following are ways the biocides impact microorganisms?… |
| 4622 | Magnesium is a ____ and one of its functions is to ______… |
| 4625 | Match the element/compound to Macro/micronutrients and the trace elements… |
| 4627 | In what ways does retinal-based phototrophy differ from photosynthesis?… |
| 4628 | The primary function of the F<sub>1</sub> subunit within ATP Synthase is to… |
| 4629 | Which of the following is a growth factor?… |
| 4631 | Oxygen is critical for ______ because it is required in their metabolism, while many ______ can stil… |
| 4633 | One similarity between the TCA cycle and the β-oxidation includes:… |
| 4635 | Chemical biocides</p> <p> </p> <p> … |
| 4637 | Which of the following can use H<sub>2</sub>S as a source of electrons for their electron transport … |
| 4638 | In ATP synthase, what conformation is the F1 beta subunit in when ADP and inorganic phosphate react … |
| 4639 | You are a microbiologist and you think you discovered a new species of green bacteria. The genomic s… |
| 4640 | There are several factors that limit growth within microbial communities. Which of the following gro… |
| 4642 | In response to nitrogen starvation, cyanobacteria will form … |
| 4644 | A microbe living in extreme heat temperatures is called a _________ and has adapted ___________ to s… |
| 4645 | A scientist just discovered a vial containing pathogenic microbes in his lab while cleaning up. With… |
| 4647 | Which is an effective method of controlling microbial growth using physical agents?</p> <p> … |
| 4648 | The phase of growth where exponential growth ceases, and the cell number remains the same is called.… |
| 4649 | The goal of all catabolic pathways is to generate energy, normally in the form of (select all that a… |
| 4652 | What roll do light-harvesting complexes play in photosynthesis?… |
| 4654 | A species of bacteria replicates by binary fission. After 8 generations, how many bacterial cells wi… |
| 4655 | A cyanobacteria cannot obtain the nutrients necessary for survival and is thus in a state of nutrien… |
| 4661 | Describe the mechanisms that the electron transport chain uses to move protons across the membrane. … |
| 4665 | Fermentation results in the accumulation of NADH within the cell. For fermentation to continue, the … |
| 4666 | Which of the following micronutrients are needed for ATP-Dependent reactions?… |
| 4667 | Match each of the traits to the correct method of controlling microbial growth using physi… |
| 4671 | In a lake environment, cyanobacteria suddenly become subjugated to limited environmental condit… |
| 4675 | An important protein involved in creating the proton gradient across the cell membrane is NADH reduc… |
| 4682 | Bucky Badger calculated the growth rate to be -1.129 from the following data. What appears to be wro… |
| 4684 | Which of the following reactions has the largest electron potential drop in MeV?<br role="presentati… |
| 4692 | Kim Chi is a delicious, Korean food that undergoes natural fermentation and involves many … |
| 4701 | How would a microbe that uses carbon dioxide as its carbon source, light as its energy source, and i… |
| 4704 | You and a friend have started brewing beer together. Your friend thinks you should try ultra-high te… |
| 4705 | What characteristic enables green bacteria to thrive in low-light, nutrient-deprived environments?… |
| 4710 | <span style="font-size:16px;"><span style="line-height:107%"><span lang="EN-US"><span style="line-he… |
| 4712 | Which microorganism plays a key role in the fermentation process of kimchi?… |
| 4713 | You have just isolated the genome of a new microorganism. You want to find out if it can make enzyme… |
| 4717 | When do <em>Vibrio fischeri</em> exhibit bioluminescence:</p> <p> … |
| 4718 | You are trying to investigate the complete microorganism composition in your living space and decide… |
| 4721 | What is true of bacterial diversity in acid mines?… |
| 4722 | By which of the processes below do the majority of microbes in acid mines obtain their carbon?… |
| 4725 | You wish to isolate a microbe that produces vitamin B12. Which of the following techniques would all… |
| 4729 | You want to determine what metabolites are being used in a sample of mud. What technique would … |
| 4730 | What type of lake is saturated with minerals and nutrients to the point where it has an overgrowth o… |
| 4734 | During which season does the major lake mixing event occur?… |
| 4735 | Which factor directly triggers a lake mixing event?… |
| 4739 | What is the most likely cause of the mutation shown below?</p> <p> </p> <p><img height="1… |
| 4740 | In order for transcription to occur in the maltose operon, which of the following events need to occ… |
| 4744 | During environmental stress, increased temperature, the RpoH concentration ____ because the molecula… |
| 4746 | Which of the following terms best describes a lake with lots of algae growth, numerous aquatic … |
| 4749 | Regarding acid mining, which of the following are correct?… |
| 4752 | What is a characteristic of plasmids?… |
| 4758 | In catabolite repression, which molecule binds to CAP, and what happens when it binds to CAP?… |
| 4765 | In catabolite repression of the lac operon, what role does glucose play?… |
| 4766 | Which of the following describe Eukaryotes in acid mine drainage?… |
| 4767 | Which of the following descriptions accurately describes how the fungi and protozoa grow in acid min… |
| 4768 | The gene that encodes the Autoinducing Peptide (AIP) is ...… |
| 4770 | In microbes, CRISPR and cas-proteins capture viral DNA. Where is this (viral) genetic code integrate… |
| 4774 | In community physiology, what is the role of depolymerization?… |
| 4777 | Select all that apply. Catabolite repression in the <em>lac</em> operon: … |
| 4779 | Two strands of circular genetic information are present in a cell. A scientist believes that on… |
| 4780 | <em>Thermococcus atlanticus</em> is an organism that gets its energy from the oxidation of organic c… |
| 4782 | Which of the following statements on <em>Vibrio fischeri</em> are true? Select all that are tru… |
| 4784 | Which of the following occur in Methyl Mismatch Repair? (multiple answers)… |
| 4785 | If you were to remove the protein IIAGlc from the PTS complex during lac operon regulation, what wil… |
| 4786 | Which of the following is true of <em>Nitrosomonas</em> sp. and <em>Nitrobacter</em> sp.?</p> <p… |
| 4788 | Although there is some growth of microbes off of Dissolved Organic Carbon (DOC) in acid mines, most … |
| 4789 | Metabolomics is...… |
| 4794 | The isolation of <em>Pelagibacter ubique</em> included which type of medium? … |
| 4796 | Which of the following describes the symbiosis between the deep sea tube worm and sulfur-oxidizing b… |
| 4798 | Among which group are plasmids most prevalent?… |
| 4799 | In <em>Streptococcus thermophilus</em> what happens if CRISPR is effective at repelling the initial … |
| 4802 | How does the maltose activator protein increase transcription?… |
| 4803 | Which of the following is a major difference between chromosomes and plasmids?</p> <p> </p> … |
| 4804 | Which of the following characteristics is correct regarding microbes and chemical reactions within t… |
| 4806 | In lignin degradation...… |
| 4810 | You have a new microorganism that you have just isolated. You suspect your bacterium is capable of d… |
| 4812 | What type of bacterial feature acts like the human immune system?… |
| 4813 | You suspect your newly isolated bacterium is capable of degrading cellulose. Match the methods with … |
| 4814 | Which of these microbes could be found in a deep sea ocean vent community, growing on proteinaceous … |
| 4817 | Deep-sea tube worms are in a mutualistic relationship with sulfur-oxidizing bacteria. The benefit fo… |
| 4818 | _________ is the autoinducer in the <em>Agr</em> quorum-sensing system in Gram-positive bacteria (<e… |
| 4820 | Which of the following is a compound/element take up by tube worms found near deep se… |
| 4822 | The dominant bacterial species in an acid mine has Fe<sup>2+ </sup>oxidized with..… |
| 4823 | You are using the FISH method to determine if a species is present in a certain environment. Describ… |
| 4828 | Match the <em>Agr</em> (accessory gene regulator) type with its function/role in Gram-Posi… |
| 4835 | The reductive Acetyl-CoA pathway reduces CO<sub>2</sub> to _____ and _____, to combine wi… |
| 4836 | Which of the options below best describes how lignin is degraded?… |
| 4847 | After a trip to picnic point, you grabbed some soil and brought it back to the lab so you could iden… |
| 4849 | Which of the following statements best describes the physiology of the SAR11 microbial genus (<… |
| 4851 | The following reaction takes place in which step of the nitrogen cycle: NO<sub>2</sub><sup>-</sup> +… |
| 4852 | In what situations are HSP (heat shock proteins) present in the cell? … |
| 4853 | What is the best way to describe the relationship between tube worms and the bacteria inside of them… |
| 4855 | UV light often causes DNA damage, what specific mutation would it cause?… |
| 4856 | The trp operon is an example of...… |
| 4857 | What type of lake has an overabundance of nutrients and minerals and a high biological activity wher… |
| 4858 | Lake mixing occurs in the ____ and ____ seasons. This causes the oxygen concentrations and nutrients… |
| 4860 | A mutation occurs to a large section of DNA. If there IS a complementary strand _____ repair wi… |
| 4862 | For B-cells to fully mature, what must happen before they’re released into the bloodstream?&nb… |
| 4864 | Which of the following cellular events greatly contribute to an increase in tissue temperature?… |
| 4866 | What genus of microorganism is most likely to be found in the mouth as a primary colonizer?… |
| 4867 | What did John Snow's investigation allow for the conclusion of?… |
| 4868 | The actinomycetes that grow on Beowolf digger wasps…… |
| 4869 | You see a commercial touting the consumption of lemon flavonoids for managing diabetes. Your friend … |
| 4870 | Which of the following is true regarding the presence of flavonoids in the human body? … |
| 4871 | Men who enjoy hunting are more likely to get Blastomycosis. You are trying to determine the reservoi… |
| 4873 | After a significant weight loss, it is difficult for individuals to keep off the weight because thei… |
| 4874 | Chronic Wasting Disease is caused by the prion protein. How can a protein cause an infectious diseas… |
| 4875 | Your dear aunt Beatrice made tuna salad for the picnic. Unknown to everyone, after she prepared it, … |
| 4876 | What are the first phagocytes recruited when a microbe dangerous to your health is noticed?… |
| 4878 | Which of the following is considered to be an example of a carrier?… |
| 4880 | What is one function of Staphylococcus epidermidis that makes it a useful part of its normal microbi… |
| 4882 | What macromolecule(s) would the pattern recognition receptor (PRR) on a monocyte recognize?… |
| 4883 | What role do cytokine 3a and cytokine 5a play in the classic pathway?… |
| 4884 | Match the microbial symbiont to what it does for the host.… |
| 4886 | Match the following anti-microbial secretions with their correct purpose.… |
| 4887 | _____, _____ and _____ are examples of phagocytes which play this role in the immune system ________… |
| 4888 | Which is a characteristic associated with the pathogen <em>Chlamydia?</em>… |
| 4889 | Why do HIV patients have to keep taking the HIV treatment even after the virus is no longer detectab… |
| 4896 | Which of the following are true regarding <em>Staphylococcus</em>?… |
| 4897 | How is a proton gradient created during acetogenesis?… |
| 4900 | Which of the following viruses would be categorized as an oncovirus?… |
| 4902 | A bacteria may develop resistance to an antibiotic if it has a...… |
| 4903 | Which of the following involves a correct description of a microbial partnership?… |
| 4904 | Which of the following correctly describes acetogenesis?</p> <p> </p> <p> … |
| 4907 | B cells undergo clonal expansion and create two cell types. What are they?… |
| 4908 | Weight gain is impacted by the microbiome because when a person consumes a high-fat diet, the amount… |
| 4909 | All of the following are ways in which vaccines protect people from disease except...… |
| 4912 | Consider <em>Plasmodium</em> sp.… |
| 4913 | Which of the following are beneficial functions of <em>Staphylococcus epidermidis</em>?… |
| 4914 | What correctly matches a general class of vaccine with an example of it? Select all correct answers.… |
| 4915 | You are outside and suddenly you are stung by a bee, but you are allergic to bee stings. Which type … |
| 4917 | Which of the following is true about EHEC (enterohemorrhagic <em>E. coli</em>)?<br /> … |
| 4918 | Which of the following is a common early symptom for SARS-CoV-2 (COVID-19)?… |
| 4919 | Which of the following are correct regarding Malaria?… |
| 4926 | How is chronic wasting disease transmitted between deer?… |
| 4929 | Which of the following microbes uses unique C1 carriers reduced by hydrogen gas in its metabolism to… |
| 4932 | Acetogenesis is a anaerobic process that generates acetate and ATP by...… |
| 4933 | Which of the following is true regarding endotoxins and exotoxins?… |
| 4934 | Prions (chronic wasting disease) are transmitted by… |
| 4935 | Which of the following are symptoms of a <em>C. difficile </em>infection?… |
| 4936 | What is the primary role played by the epithelial barrier in the body’s immune response?… |
| 4937 | What molecular cues attracted the phagocytes to an area?</p> <p> </p> <p> </p> <p… |
| 4938 | Which of these characteristics correctly describe a reservoir?… |
| 4940 | What is the role of cytokines in TSST?… |
| 4942 | Which of the following is a common role of a neutrophil?… |
| 4943 | Which of the following cells matches the function… |
| 4944 | How could low to no colonization levels of the bacterium <em>Akkermansia muciniphila</em>&… |
| 4945 | The addition of <em>Akkermansia muciniphila</em> to the microbiome has been shown to reverse the unh… |
| 4947 | As the lymphocyte matures, antibodies and TCR diveristy is created by...… |
| 4948 | Which of the following pathogens inject effector proteins directly into host cells:… |
| 4949 | <em>Syntrophomas </em>bacteria oxidize butyrate to acetate to make ATP and generate hydrogen gas as … |
| 4950 | Your friend has <em>Chlamydia pneumoniae</em>, and like every college student, refuses to go to the … |
| 4951 | How do CD8 cells (cytotoxic T-cells) partner with MHC complexes to trigger an immune response?… |
| 4952 | Why does better sanitation decrease the incidence of disease?… |
| 4953 | What is true regarding the inflammatory role of a cytokine?… |
| 4955 | Match the antibiotic to their bacterial target… |
| 4958 | What is the primary purpose of antigen presentation by dendritic cells and macrophages in the immune… |
| 4959 | SARS-CoV2 enters the cell by first attaching to the enzyme receptor ______. The virus is then taken … |
| 4960 | In regards to phagocyte mechanisms to kill bacteria...… |
| 4961 | Another name for CD8+ T-cells is...… |
| 4962 | HIV is a deadly virus that is spread through contaminated bodily fluids and attacks CD4-expressing c… |
| 4963 | Which of the following correctly matches an antibody with its proper function. … |
| 4964 | There is a population the lactic-acid bacteria <i>Streptococcus gordonii, </i>a producer, that thriv… |
| 4965 | Which of the following substances functions by binding to bacteria and assisting in clearance by pha… |
| 4967 | Which of the listed complement proteins may be directly involved in activating the membrane att… |
| 4968 | In John Snow's experiment to isolate the source of a Cholera outbreak, what was the source of ou… |
| 4969 | Which is TRUE about a vaccine that can be used to prevent against measles?… |
| 4972 | In T and B cell maturation…… |
| 4973 | Which of the following pathogen behaviors is possible due to a type III secretion system?… |
| 4975 | Which of the following accurately describes the course of chlamydia in the body?… |
| 4977 | Upon the formation of the CoB- CoM complex, where does the electrons for this process come from and … |
| 4980 | Which of the following interactions is most important in stabilizing the overall double-stranded hel… |
| 4982 | RNA polymerases in archaea recognize the start site in transcription...… |
| 4985 | After discovering a new microorganism, you determine that its DNA can <u>only</u> be transcribed in … |
| 4986 | Match the person with their work in microbiology.… |
| 4988 | If the host cell's protease (FtsH) level is high, what would bacteriophage lambda do? … |
| 4991 | A scientist is interested in finding a type of DNA helicase that can withstand extremely high t… |
| 4994 | Which of the following molecules or structures do Gram-positive bacteria lack that provides Gram-neg… |
| 4995 | If a disease-causing agent is mostly inactive (does not grow) in the cell, which drug, penicill… |
| 4996 | Why is Robert Hooke important to Thonis Philipszoon (Anton von Leeuwenhoek)?… |
| 4999 | Different viruses have different life cycles but T4 has similarities to both Qβ and lambda phag… |
| 5001 | How does a virus remain undetected in a lysogenic infection?… |
| 5003 | Which of the following structures is found in a bacterial cell <strong>and</strong> <strong>not… |
| 5004 | What is the major difference between archaea cell membranes and bacteria cell membranes? … |
| 5006 | Which of the following is a characteristic unique to Eukarya?… |
| 5007 | Which of the following statements best reflects the relationship between organisms based on a phylog… |
| 5008 | Which of the following statements best describes the amphipathic nature of lipids and their role in … |
| 5010 | Which of the following is true for Archaea but does not apply to bacteria or eukaryotes? … |
| 5012 | Which of these scientists isolated the first extreme thermophiles (<em>Thermus aquaticus</em>) that … |
| 5014 | While observing various viruses, you notice a virus that contains nucleic acids, a capsid, and an en… |
| 5015 | Which of the following is true in the relationship between Archaea and Eukarya? … |
| 5018 | What best describes the composition of a ribosome?… |
| 5019 | Which of the following differentiates archaea from bacteria?… |
| 5020 | Which choice correctly supports the Endosymbiotic Theory that chloroplasts originate from cyanobacte… |
| 5023 | Compared to Archaea and Bacteria, Eukaryotes have...… |
| 5024 | <div class="question_text user_content enhanced" id="question_8106559_question_text">Many organisms … |
| 5026 | What characteristics about translation are specific to prokaryotes?… |
| 5027 | Which three basic functions of life are found in ALL microbial cells (microbes)?… |
| 5028 | A lab was trying to analyze a virus and found it to contain only DNA and proteins, what type of… |
| 5031 | Which one of these options correctly describes the rotary motion that occurs in flagella in <em>E. c… |
| 5033 | T4 is a virus that regulates when it expresses certain genes. It does this through:… |
| 5034 | Lipids that make up the cell membrane in Archaea differ from the lipids that make up the cell membra… |
| 5036 | What are the differences between RNA and DNA that make DNA used as the hereditary material?… |
| 5037 | What are the metabolic functions and contributions of gas vesicles and where are they primarily loca… |
| 5042 | Which of the following accurately describes the structure and function of peptidoglycan in bacterial… |
| 5046 | Which of the following is a difference between the structures of RNA and DNA?… |
| 5048 | What is the purpose of molecular chaperones in the synthesis of proteins? … |
| 5052 | Which of the following would be degraded in the presence of lysozyme?</p> <p> </p> <p>&nb… |
| 5053 | Robert Koch was responsible for which major contribution to the field of microbiology?</p> <p>&nb… |
| 5054 | What characteristics do all three Domains share in the Phylogenetic tree?… |
| 5055 | Which of the following are similarities between RNA polymerase in archaea and bacteria?… |
| 5058 | A main difference between rho-independent and rho-dependent termination is that… |
| 5059 | Protein synthesis occurs in which organelle in eukaryotic cells?</p> <p> </p> <p> … |
| 5069 | A major structural difference between the Gram-positive and Gram-negative cell wall is...</p> <p>… |
| 5070 | Who did Edward Jenner first inoculate and what did he inoculate them with? … |
| 5075 | Which of the following are correct when considering the structure of lipopolysaccharide? (Select all… |
| 5078 | Compare the cytoplasmic membrane and the slime layer of a bacterial cell and choose which answer cho… |
| 5081 | Type I pili and Type IV pili differ in that ____.… |
| 5082 | Why did variolation of smallpox still have a 1% to 2% mortality rate which is high by todays st… |
| 5084 | How do cytoskeleton proteins contribute the stability of a bacterial cell?… |
| 5085 | A similarity between archaea and eukaryotes is they both have … |
| 5086 | How can prions be infectious?… |
| 5089 | Which of the following is not an ingredient in making beer?… |
| 5090 | Compare β-oxidation to the TCA cycle. Which of the following statements is true? … |
| 5091 | What bacteria are responsible for the first step of Kim Chi fermentation that ferments sugar to acid… |
| 5094 | When operating an autoclave…… |
| 5096 | One way microbes cam avoid predators is… |
| 5098 | Purple bacteria make a better experimental model for understanding photosynthesis than green bacteri… |
| 5099 | What is the difference between the retinal-based phototrophy and the photosynthetic apparatus of pur… |
| 5100 | Match the major growth limiting factors with the adaptations used by microbes to combat th… |
| 5102 | Which of the following is most likely to cause the solidification of the cell membrane and decreased… |
| 5103 | Which of these is options is a major difference between oxidative phosphorylation and photophos… |
| 5104 | There are many ways in which microbial populations are kept in check, which of the below factors wou… |
| 5105 | What are the three ways microbes respond to limited nutrients in their environment?</p> <p> … |
| 5106 | During fermentation NAD+ is almost always ______ to NADH. Fill in the blank.… |
| 5107 | A green apple taste, or acetylaldehyde, can accumulate during beer fermentation in which of the foll… |
| 5108 | When dealing with temperature to remove microorganisms from a substance, the MOST effective manipula… |
| 5110 | What is the classification and example function of magnesium in the cell?… |
| 5115 | The growth of <em>Lactococcus lactis</em> requires adenosine for growth because it cannot make its o… |
| 5119 | Superoxide dismutase is an enzyme that is found only in...… |
| 5120 | Which method of control would you use to sterilize a plastic container for medical equipment?… |
| 5121 | Which of the following is unique to Green Bacteria compared to Purple Bacteria and Cyanobacteri… |
| 5123 | Compare the differences and similarities of the light-harvesting complexes of purple, green, and cya… |
| 5124 | The number of photons available limits photosynthesis. Light harvesting complexes helps maximiz… |
| 5128 | A major difference between Photosynthesis and Retinal-based Phototrophy is...… |
| 5129 | Which of the following best describes the link between the dissipation of the proton gradient and th… |
| 5131 | You are testing the growth rate of a sample of <em>E. coli </em>in a lab. You get a C… |
| 5133 | Which of the following oxidants would create an equilibrium in favor of reducing NAD to NADH?</… |
| 5134 | Which of the following are strategies that microbes utilize to protect themselves from predation? Se… |
| 5137 | What is true of the light-harvesting photosystems of purple, green, and cyanobacteria?</p> <p>&nb… |
| 5138 | What structure/s pump protons across the membrane in both photophosphorylation and oxidative ph… |
| 5140 | Which of the following could not survive in the presence of oxygen? (select all that apply)… |
| 5141 | Which is a difference between biocides and antibiotics?… |
| 5142 | Which starting material in the cellular respiration reaction is getting oxidized:</p> <p>C<sub>6<… |
| 5143 | Which of the following is true regarding the division of the cell?… |
| 5144 | If <em>E. coli</em> is in an environment where it runs out of carbon sources, how might it… |
| 5146 | When brewing a batch of beer, you find that your product tastes of bitter green apple. This was not … |
| 5147 | The Min system in <i>E. coli </i>is utilized by the cell in order to complete what process?… |
| 5150 | Which type of differentiated Cyanobacterial cell has the main purpose of fixing nitrogen, and how do… |
| 5151 | What type of structures are used in green bacteria to capture light, and what is the important subst… |
| 5154 | While trying to produce cheese, you discover that your curds are not knitting properly, and your res… |
| 5155 | A scientist identified two new important cellular reactions in bacteria: reaction 1: A+B—&mdas… |
| 5157 | Light harvesting complexes in purple bacteria… |
| 5160 | Which photopigment has the main job of quenching the triplet state of chlorophyll to preve… |
| 5161 | Which is an example of substrate level phosphorylation in fermentation?… |
| 5164 | What Physical Agent would be the used to sterilize glass pipets?… |
| 5166 | During the heat shock response, the level of heat shock proteins increases, one reason translation i… |
| 5169 | How do Sulfur-Oxidizing bacteria benefit tube worms in hydrothermal vents?… |
| 5170 | The major difference between the lac operon and the trp operon is...… |
| 5172 | How are plasmids maintained in bacterial cells?… |
| 5173 | How is it possible for the <em>lac</em> operon to have allolactose as the inducer when it is made fr… |
| 5175 | When asked to determine both the phylotypes present in a soil sample <u>as well as the metaboli… |
| 5176 | You are investigating a new operon that synthesizes ladderines. You find that the final product bind… |
| 5177 | Which of the following is <strong>NOT</strong> a characteristic of the reductive Acetyl-CoA pathway?… |
| 5178 | Which of the following are NOT properties of Pelagibacter Ubique's physiology?… |
| 5179 | A team of submarine scientists isolate several species of bacteria near a deep sea ocean vent. Which… |
| 5180 | What is denitrification and its significance?… |
| 5182 | Which of the following statements about the lux operon are <strong>true</strong>? … |
| 5183 | What is the main difference between a Plasmid and a Chromosome?… |
| 5184 | You take a soil sample and create a wet mount that you stain with DAPI (stains DNA). Using the… |
| 5185 | Which of the following statements correctly contrasts quorum sensing mechanisms between Gram + bacte… |
| 5186 | In the mechanism of proteorhodopsin, the retinal…… |
| 5187 | Which of the following is a major product of all kinds of metabolism under both aerobic and anaerobi… |
| 5188 | In which of the following situations would you <strong>not</strong> expect to find heat shock protei… |
| 5189 | Which of the following phylotypes were discovered by the Sorcerer II expedition?… |
| 5190 | Which characteristic of Ferroplasma acidarmanus, an archaea that is found in acid mines, i… |
| 5191 | Which of the following would you assign to a lake with low growth, low nutrients, clear water, and l… |
| 5192 | Mobile genetic elements are found in, … |
| 5193 | There is a double strand break in the DNA, but there are still both complementary strands. How would… |
| 5194 | Besides bacteria that can oxidize iron and/or sulfur compounds, eukaryotic species found in aci… |
| 5195 | What medium will Peligabacter ubique grow successfully in? … |
| 5197 | The <em>trp</em> operon includes a <em>trp</em> repressor protein that is s… |
| 5198 | You have a strain that produces vitamin B12 and secretes it into the growth medium. Which option wou… |
| 5199 | What is the primary role of Nitrobacter in the nitrogen cycle?… |
| 5200 | A major difference between the <em>T. atlanticus </em>and <em>G. ahangar</em>i species is … |
| 5201 | Lake Mendota has high biological activity and excessive nutrients like phosphorus and nitrogen. What… |
| 5202 | Which of the following activates the inactive repressor in the <em>trp </em>operon?… |
| 5204 | When comparing key processes of the nitrogen cycle, which of the following is strictly an aerobic pr… |
| 5207 | Color indicator plates are screens, not selection because.......… |
| 5208 | Which general group of microorganisms breaks down cellulose, chitin, lignin, and protein into smalle… |
| 5209 | Match the correct conditions with their role in cellulose degredation.… |
| 5210 | What is a difference between a plasmid and a chromosome?… |
| 5212 | Which of the following repair methods should be used to repair DNA modified by a frameshift mutation… |
| 5213 | Which of the following is true about transposons?</p> <p> </p> <p style="line-height:1.2"… |
| 5215 | What are some physical and chemical characteristics of deep-sea ocean vents? … |
| 5217 | Are chemoorganoheterotrophs found in deep sea ocean environments?… |
| 5219 | Which enzyme is specifically associated with the degradation of cellulose under anaerobic conditions… |
| 5220 | In the lac operon, what role does the repressor play when lactose is absent?… |
| 5223 | During the spring what would you expect to see in a lake?… |
| 5224 | In the reductive Acetyl-CoA pathway, where does the reducing power come from?|… |
| 5225 | You have a strain of bacteria that produces vitamin B12 and secretes it into the growth medium. How … |
| 5228 | Which of the following descriptions of the eukaryotes living in acid mines is correct?</p> <p>&nb… |
| 5230 | Which protein(s) of the <em>lux</em> operon synthesizes the autoinducer?… |
| 5231 | What is the difference between aerobic and anaerobic methane oxidation?… |
| 5233 | Which of these steps occurs in both gram-positive and gram-negative quorum sensing?… |
| 5234 | Your PI asked you to perform a transformation of your newly constructed plasmid pIA123 into competen… |
| 5235 | Which of the following techniques are NOT used in metabolomics?… |
| 5239 | You have just successfully isolated a new microorganism and you suspect it is able to degrade cellul… |
| 5240 | Are eukaryotic microbes found in acid mine drainages? If so, how do they grow?… |
| 5242 | What is a major difference between the <em>lac</em> operon and the <em>trp</em> operon?… |
| 5243 | Choose which of the following accurately completes this statement: The expression of the <em>lac</em… |
| 5248 | Which are accurate environmental characteristics of deep-sea ocean vents?… |
| 5249 | Which of the following molecules is specifically involved in quorum sensing in the Gram-positive bac… |
| 5259 | Which of the following could be considered a probiotic?… |
| 5260 | Pink eye is a common type of bacterial conjunctivitis that results in the whites of the eye turning … |
| 5262 | Which statement best describes the pathogenesis of <em>Clostridium difficile</em> infection?… |
| 5263 | What are the symptoms of inflammation? (4 correct answers) … |
| 5264 | What are B-lymphocytes role in the immune system? … |
| 5265 | What is acetogenesis? … |
| 5267 | Which of the following are true aspects of the <em>Akkermansia muciniphila</em> symbiosis … |
| 5271 | What microbes are present on human skin? (Select all that are correct.)… |
| 5272 | Match each symptom of inflammation to its cause at the cellular level. … |
| 5277 | A major difference between CD4+ T-cells and CD8+ T-cells is that...… |
| 5279 | Which of the following are considered phagocytes in the body? (Select all that are correct)</p> <… |
| 5281 | Which of the following is true of endotoxins and exotoxins?… |
| 5283 | Match the antibody to the correct function… |
| 5288 | Two of the major proteins found in the envelope of the influenza A virus are: (Select all that are c… |
| 5289 | Under a high-fat diet in mice, which of the following are true? Check all that apply. … |
| 5290 | How does the microbiota of an individual with a high fat diet differ from the microbiota of an indiv… |
| 5291 | If a healthy person's GI tract was colonized by a high-fat diet microbiome what would most likel… |
| 5292 | Phagocytosis is an important part of antigen presentation used by what cells?… |
| 5294 | A patient comes in complaining of severe abdominal pain that is accompanied by bloating and diarrhea… |
| 5296 | Which answer correctly describes how a vaccine protects you from disease?… |
| 5298 | What impacts the differentiation of phagocytes?… |
| 5300 | In methanogenesis, ____ only accepts electrons, resulting in a proton gradient… |
| 5301 | Which of the following are ways in which the skin is a barrier to microbes? (select all that ap… |
| 5302 | Which type(s) of antibacterial antibiotic target cell wall synthesis?… |
| 5303 | The following are characteristics of primary symbionts of insects:… |
| 5304 | A pathogen has entered a cut in your skin. Which of the following will lead to phagocytosis? Select … |
| 5305 | What is the role of opsonins?… |
| 5308 | Previously, we learned about Edward Jenner and his creation of the first vaccine for smallpox from c… |
| 5309 | The complement system is an enzymatic system composed of 9 proteins that help the body fight pa… |
| 5311 | Rank the following antigens by their strength in interacting with antigen-specific receptors on the … |
| 5313 | The large diversity of variable regions on T cells receptors and antibodies is created via:… |
| 5317 | Which of the following general classes of vaccines are matched up with the right immune response res… |
| 5318 | Which of the following is caused by dysbiosis in the gut microbiome?… |
| 5319 | How are antibodies able to diversify themselves to provide protection from the wide variety of patho… |
| 5320 | Penicillin…… |
| 5321 | A patient comes in with the following symptoms: abdominal pain, fever, vomiting, and bloody diarrhea… |
| 5322 | Which of these things are true of macrophages? (2 correct answers) … |
| 5323 | Which of the following are correct statements about the actions / targets of various antibiotics?… |
| 5324 | Which cell type plays a central role in initiating adaptive immune responses by capturing <strong>an… |
| 5327 | Which of the following is true about chlamydia?… |
| 5329 | The role of <em>Akkermansia muciniphila</em> in humans is:… |
| 5331 | Select the following options that are TRUE regarding microbes in the gastrointestinal (gut) tract</p… |
| 5332 | Describe the structure of the gut epithelium. What is the role of all the immune cells in gut health… |
| 5333 | Match the immunoglobulin class to its function… |
| 5335 | Which of the following is an example of a producer and consumer bacteria in a syntrophic relationshi… |
| 5337 | The cardinal signs of inflammation are...… |
| 5343 | The formation of extracellular polymers (glucans) in <em>S. mutans </em>and <em>S. sanguis </em>atta… |
| 5344 | Because it has porins, the outer membrane is a permeability barrier.… |
| 5345 | From a population perspective, what percent of life on Earth is microbial?… |
| 5346 | From a biomass perspective, what percent of life on Earth is microbial?… |
| 5347 | If you compare the <em>average size</em> of the following microbes, which is the <em>smallest</em>?… |
| 5348 | If you compare the <em>average size</em> of the following microbes, which is the <em>largest</em>?… |
| 5349 | Which of the following are positive impacts of microorganisms?… |
| 5350 | Negative impacts of microorganisms on human society include...… |
| 5351 | Bacteria cause harm to humans by killing or inhibiting the growth important crops… |
| 5352 | In industry, microorganisms contribute in many positive ways. For example (There are three correct a… |
| 5353 | The structure shown is a... <img alt="A sugar baby" src="https://instruction.bact.wisc.edu/images/q… |
| 5354 | Bacterial DNA is located within the nucleoid. This is organize by… |
| 5355 | A carboxysome is an enzyme complex that… |
| 5356 | Only living organisms can synthesize organic compounds such as amino acids.… |
| 5357 | Let's compare a yeast cell (a non-photosynthetic microorganism) to a bacterial cell like <em>E. coli… |
| 5358 | In comparing the cell membrane of <em>E. coli</em> (Bacteria) to <em>Methanothermobacter thermautotr… |
| 5359 | Order the steps of viral infection.… |
| 5360 | Here is a typical viral particle...</p> <img alt="A diagram of a virus" src="https://instruction.ba… |
| 5361 | Bacterial transcription is different from Archaea and Eukarya in that… |
| 5362 | A (+) ssRNA virus that infects a Eukaryotic cell would most likely replicate in…… |
| 5363 | In rho-dependent termination in bacteria, the rho protein…… |
| 5364 | The actual process of translating from the language of nucleotides (codons) to protein is carried ou… |
| 5365 | If you are trying to classify a microorganism phylogenetically, what trait would be best to look at?… |
| 5366 | The last universal common ancestor (LUCA) probably generated energy by…… |
| 5367 | Microorganisms can affect the food supply chain by...… |
| 5368 | If truck drivers get sick because of influenza, that can disrupt the food supply chain.… |
| 5369 | One way to prevent leaf rust (caused by <em>Puccinia triticina Eriks</em>) from inhibiting your whea… |
| 5370 | Leaf rust affects the food supply chain by...… |
| 5371 | Pick all the elements that are macronutrients… |
| 5372 | Pick all the elements that are macronutrients… |
| 5373 | Pick all the elements that are micronutrients… |
| 5374 | <em>Shighella dysenteriae</em> requires NAD to be able to grow. Therefore, NAD is a ________________… |
| 5375 | <em>Bacillus cereus</em> requires the element magnesium for growth. This makes Mg a growth factor fo… |
| 5376 | Here is the recipe of a medium:</p> <p> </p> <table border="1" cellpadding="1" cellspacin… |
| 5377 | Here is the recipe of a medium:</p> <table border="1" cellpadding="1" cellspacing="1"> <thead> … |
| 5378 | <img alt="The electron potential table" height="412" src="/images/quickcheck/electrontower.png" widt… |
| 5379 | Substrate phosphorylation (SLP) differs from electron-transport level phosphorylation (ETLP) in that… |
| 5380 | The latter steps in fermentation often involve the reduction of an organic substrate (i.e. The reduc… |
| 5381 | You add <em>Lactococcus lactis </em>(a homofermentative bacterium) as a starter culture to your milk… |
| 5382 | During chocolate fermentation, spore-forming bacteria dominate late in the process. This is because… |
| 5383 | The FtsZ protein is common in many types of cells. It is required for...… |
| 5384 | If a cell lost the activity of the FtsZ protein it would...… |
| 5385 | An advantage turbidity measurements have over viable plate counts are…… |
| 5386 | A microorganisms that forms long tubes, called mycelia, increases by… |
| 5387 | A stalked bacterium that divides into two unequal cells use this mode of cell division.… |
| 5388 | Some of the advantages for bacteria living in a bioflim are…… |
| 5389 | The disadvantages of living in a biofilm are…… |
| 5390 | Temperature kills bacteria because…… |
| 5391 | Temperature kills bacteria because…… |
| 5392 | A bacterium grows in a high-temperature (70°C) hot spring at pH 3. You would classify this bacterium… |
| 5393 | If a bacterium doesn't have superoxide dismutate or catalase it is probably a… |
| 5394 | Bacteria can survive without carbon sources in the environment because they store carbon in…… |
| 5395 | Sulfur-oxidizing bacteria if they run into excess hydrogen sulfide will store it as… |
| 5396 | When the bacterium <em>E. coli</em> begins to starve, it will change the expression of many genes by… |
| 5397 | When Giardia is released from a host into the environment, it will…… |
| 5398 | The most hardy form of resting structure is a…… |
| 5399 | The cyanobacteria <i>Anabaena variabilis</i> can differentiate in three ways. Which differentiated c… |
| 5400 | The cyanobacteria <i>Anabaena variabilis</i> can differentiate in three ways. Which differentiated c… |
| 5401 | The majority of nitrogen fixation on Earth is done by Bacteria… |
| 5402 | The majority of nitrogen fixation on Earth is done by humans… |
| 5403 | Conversion of ammonia to nitrate involves (There are two correct answers)… |
| 5404 | A farmer spreads nitrogen fertilizer (nitrate) on his corn crop and expects it to increase his yield… |
| 5405 | Loss of food to spoilage by microorganisms is a significant problem in our food supply chain… |
| 5406 | Sterilization is the…… |
| 5407 | Disinfetion is…… |
| 5408 | What physical treatment would you use to sterilize a liquid that contains bacteria as well as small … |
| 5409 | You want to preserve some meat for the winter in your cabin. However, the power supply to the cabin … |
| 5410 | The main goal of wastewater treatment is to…… |
| 5411 | The main difference between water treatment to produce drinking water and wastewater treatment befor… |
| 5412 | In β-oxidation…… |
| 5413 | In the degradation of n-octane from oil, octane is converted into a fatty acid and then Conenzyme-A … |
| 5414 | The energy of high-potential electrons is converted into charge separation across the membrane by th… |
| 5415 | An <em>E. coli</em> strain has a mutation in the <em>lacZ</em> gene such that it cannot produce its … |
| 5416 | The <em>lac</em> operon encodes a repressor. The repressor is inactivated by its signal molecule all… |
| 5417 | In <em>E. coli </em>the <em>lac</em> operon is regulated by…(There are two correct answers)… |
| 5418 | MalT controls maltose operon gene expression. This protein is...… |
| 5419 | If AgrB of the quorum sensing system of <em>Staphylococcus aureus</em> was inactivated, what part of… |
| 5420 | What would happen to <em>E. coli</em> cells growing under normal conditions (i.e., no DNA damage) if… |
| 5421 | You are trying to understand a biofilm that forms on your patients' catheters. You need to know what… |
| 5422 | Amplicon sequencing is different than metagenomics in that.… |
| 5423 | Your, old, old, old school professor, is interested in learning the microbiome of moldy bread. He ch… |
| 5424 | You are investigating landfill that has been contaminated with oil. Before you start investigating … |
| 5425 | The fungus Phanerochaete chrysosporium degrades lignin. If you were putting it in a community physio… |
| 5426 | Cellulose is degraded by…… |
| 5427 | Some <em>Syntrophomonas</em> sp. oxidize butyrate into acetate and hydrogen. This reaction is only f… |
| 5428 | The bacterium ac1-B1 is one of te most common phylotypes in lakes. In the oceans, <em>Pelagibacter u… |
| 5429 | Besides sodium chloride, oceans differ chemically from fresh water in that oceans have...… |
| 5430 | The most common microbial genera found in the oceans is…… |
| 5431 | <em>Pelagibacter ubique</em> was difficult to isolate because it…… |
| 5432 | <em>Prochlorococcus</em> sp and <em>Synechococcus</em> sp. are found throughout the ocean's surface … |
| 5433 | Methanogens that grow on hydrogen gas and carbon dioxide are present at deep-sea ocean vents.… |
| 5434 | What are the properties of <em>Geoglobus ahangari</em>, a deep-sea ocean vent bacterium? (There are … |
| 5435 | Because of the lack of dissolved organic carbon chemoheterotophic bacteria are <strong>not</strong> … |
| 5436 | The most important role of carotenoids in photosynthesis is…… |
| 5437 | The purpose of light-harvesting complexes in photosynthesis is to…… |
| 5438 | If you removed the magnesium ion from the special pair of bacteriochlorophyll, it would no longer be… |
| 5439 | Chlorosomes differ from phycobilisomes (the light-harvesting complexes of cyanobacteria) in that chl… |
| 5440 | Purple bacteria are unusual for photosynthetics because they have several modes of growth. They can … |
| 5441 | Methylotrophs are autotrophs that generate organic carbon using the…… |
| 5442 | One of the major differences between aerobic vs anaerobic methane oxidation is…… |
| 5443 | Fermenting organisms need a lot of organic compounds because they get less energy from each substrat… |
| 5444 | If you had a mutation in adenylate cyclase such that it no longer could make cAMP, this mutant <em>E… |
| 5445 | The RNA III product used in quorum sensing in <em>Staphylococcus aureus </em>is an example of…… |
| 5446 | Given the physiology of the ocean, where will you find photosynthetic bacteria?… |
| 5447 | The majority of carbon dioxide put into the atmosphere comes from humans sources.… |
| 5448 | Deep-sea ocean vents are teaming with life because…… |
| 5449 | The skin is an effective antimicrobial barrier for many microorganisms because…… |
| 5450 | <div class="question_text user_content enhanced" id="question_new_question_text"> One example of ho… |
| 5451 | Two examples of antimicrobial secretions your immune system creates are…… |
| 5452 | If a person had a gene mutation that prevented them from making the cytokine interleukin 12, it woul… |
| 5453 | Complement can be activated in three ways. They are…… |
| 5454 | One way that the complement system kills microorganisms when activated is by…… |
| 5455 | One symptom of inflammation is redness. This is caused by…… |
| 5456 | The major phagocytic cells in the body are (there are three correct answers.)… |
| 5457 | Activation of the complement cascade will result in the migration of phagocytes to an area.… |
| 5458 | C3b and IgG are both opsonins. In this capacity, they…… |
| 5459 | Phagocytes can kill in several ways. Which of the following is an oxygen-independent method?… |
| 5460 | Pattern Recognition Receptors (PRR) react to _________ and alert the immune system.… |
| 5461 | An example of a MAMP that the immune system would respond to is…… |
| 5462 | The human immune system can respond to millions of antigens, yet the genome consists of only 30,000 … |
| 5463 | Dendritic cells are a special class of neutrophils that can kill bacteria, but are also antigen-pres… |
| 5464 | When activated, a B-cell will differentiate into… (There are two correct answers)… |
| 5465 | One way antibodies cause harm to pathogens by…… |
| 5466 | A cytotoxic T-cell. (Tc) will sense a host cell is infected by a virus when… (Note: anot… |
| 5467 | CD4+ T-cells (T-helper cells) function to…… |
| 5468 | If plants did not form mutualistic relationships with mycorrhizal fungi, they would have a harder ti… |
| 5469 | Rhizobia are attracted to plants because…… |
| 5470 | Consider they ratio of phylotypes found in the skin microbiota. If you compare people's skin mic… |
| 5471 | <em>Staphylococcus epidermidis </em>is found on the skin of 100% of people. This bacterium has many … |
| 5472 | The biggest impact disruption of sleep has on the microbiome is…… |
| 5473 | One of the best pieces of evidence that the microbiome can influence depression and anxiety is&helli… |
| 5474 | We say so corporation has developed a new probiotic that contains <em>Eubacterium</em> and <em>Copro… |
| 5475 | Your uncle, who is at risk for heart disease, doesn't want to eat more fiber. He says eating mor… |
| 5476 | Match the causative agent with the virulence factor/properties… |
| 5477 | An insect vector transmits these two disease agents.… |
| 5478 | Earlier in the year, we talked about Prion diseases. These diseases can satisfy Koch's postulate… |
| 5479 | The shiga toxin produced by <em>Escherichia coli</em>, is a…… |
| 5480 | You are investigating a new operon that synthesizes ladderines. You find that the final product bind… |
| 5481 | You suspect that carbenicillin resistance can move from <em>Bucky borderii, </em>a harmless bac… |
| 5482 | <em>Akkermansia muciniphila</em> is an inhabitant of the gastrointestinal tract and has an important… |
| 5483 | The microbiota on teeth that form plaque may play a role in causing.… |
| 5484 | Water coming from a surface source is not safe due to contaminants. The water is first passed throug… |
| 5486 | A patient is treated with an antibiotic with a mechanism of action that involves inhibiting transpep… |
| 5487 | All of the following are steps and appropriate descriptions of the Virus life cycle EXCEPT… |
| 5490 | Why is DNA used as the primary hereditary material instead of RNA?… |
| 5491 | After replictaion a section of DNA ends up with a mutation. However, after translation, the mutated … |
| 5492 | A scientist studies two RNA viruses. Virus A can be translated by host ribosomes immediately after i… |
| 5494 | What is the defining feature of a <strong data-end="601" data-start="578">lysogenic infection</stron… |
| 5495 | Which statement accurately describes the relationship between the lytic and lysogenic cycles?</p> … |
| 5496 | A newly discovered microorganism is found to have membrane lipids composed of isoprenoid side chains… |
| 5497 | In what way does most water enter bacterial cells? … |
| 5498 | You stain a bacterial cell and observe under a light microscope a clear thick border around the edge… |
| 5500 | The three main components of LPS in Gram-negative cells are… |
| 5502 | A key difference in the regulation of lytic versus lysogenic pathways between bacteriophage T4 and l… |
| 5503 | RNA is always single stranded and DNA is double stranded. True or false?… |
| 5507 | An antibiotic specifically targets lipopolysaccharide (LPS). Which group of bacteria would be most d… |
| 5508 | Which of the following correctly describes a structural difference between DNA and RNA?… |
| 5509 | A scientist discovers two bacterial isolates have 16S rRNA sequences that are 99% similar, but … |
| 5510 | Two populations of the same bacterial host are infected with bacteriophage λ under d… |
| 5511 | Bacteriophage λ must decide between lytic growth and lysogeny shortly after it infects <em>E. coli</… |
| 5512 | Which property is correctly associated with the indicated transport mechanism?</p> <p> </p> … |
| 5516 | Flagella and pili both can exhibit multiple conformations they can exist in, which of the following … |
| 5517 | What is an advantage of sequencing 16S rRNA that makes it useful in classifying organisms? … |
| 5518 | A bacterium is grown in a medium containing high concentrations of glucose. When the glucose is… |
| 5520 | Correctly match the person to what they are most known for… |
| 5521 | While watching SpongeBob SquarePants, a microbiology student jokes that Bikini Bottom must be f… |
| 5522 | A microbiologist compares 16S rRNA gene sequences from several microorganisms to determine their rel… |
| 5523 | Modern classification is based on phylogenetic relationships. Which of the following correctly lists… |
| 5524 | What is a unique characteristic of group transporters when compared to other transporters (pass… |
| 5527 | What main feature of eukaryotes differentiates them from prokaryotes?… |
| 5528 | A researcher isolates a microorganism from a deep-sea hydrothermal vent. The organism lacks a nucleu… |
| 5533 | A major contribution from Edward Jenner was… |
| 5535 | A researcher is studying human cell DNA and wants to test how mutations affect cell division. Which … |
| 5536 | A cell membrane transports glucose into a bacterial cell while simultaneously transporting an Na<sup… |
| 5537 | Which of the following is a function of inclusions?… |
| 5539 | Which of the following is a fundamental similarity between Eukaryotes and Prokaryotes in translation… |
| 5540 | What problem lead Louis Pasteur to the discovery of Germ Theory?… |
| 5541 | During receptor mediated endocytosis, what specialized membrane region do the receptors migrate to b… |
| 5543 | Which statement best distinguishes Eukarya from Bacteria and Archaea?… |
| 5544 | Which of the following best explains why 16S rRNA is widely used to construct phylogenic trees?… |
| 5545 | Which of the following are features shared in all three domains of life?… |
| 5546 | When developing the Germ theory, Louis Pasteur studied which of the following… |
| 5547 | During the development of solid culture techniques, a microbiologist observed that the medium liquef… |
| 5548 | What is a major difference in promoter recognition between bacteria and eukarya?… |
| 5549 | What is one of the major differences between the lytic and lysogenic cycles for phage? … |
| 5550 | The main difference between rho-dependent and rho-independent termination is ...… |
| 5551 | A major difference between a bacterial capsule and the slime layer is… |
| 5552 | Which are evidence for endosymbiotic theory across all domains?… |
| 5553 | You are a virus trying to invade a host cell. Your genetic information is single-stranded, and it ha… |
| 5554 | Which molecule targets peptidoglycan at the cross bridges… |
| 5555 | Which molecule targets peptidoglycan at the cross bridges… |
| 5556 | Match one of the three domains of life: Bacteria, Archaea, or Eukarya with one of their properties.… |
| 5557 | Match one of the three domains of life: Bacteria, Archaea, or Eukarya with one of their properties.… |
| 5558 | The DNA double helix forms when two antiparallel strands of nucleotides associate. Which mechanism c… |
| 5559 | A microbiologist wants to determine the evolutionary relationship between two newly discovered micro… |
| 5560 | A student is examining an unknown microorganism and observes that it lacks a membrane-bound nucleus … |
| 5561 | Which is a difference between the cell membrane of Bacteria and Archaea?</p> <p> </p> <p>… |
| 5562 | lysosome, which breaks bonds between NAG and NAM, is introduced to a bacterium. The cell becomes fra… |
| 5563 | What was a major contribution Angelina and Walter Hesse made to the field of microbiology?… |
| 5564 | A key difference between DNA and RNA is that DNA contains thymine while RNA contains uracil. Why doe… |
| 5565 | What feature of Archaea help them survive in extreme environments?… |
| 5566 | <meta charset="UTF-8" /><span style="font-family:Times New Roman,Times,serif;">Which transport mecha… |
| 5567 | A key difference in the structure between Gram-positive and Gram-negative cells is that gram negativ… |
| 5568 | <strong data-end="382" data-start="184">A researcher isolates a virus that has a negative single-str… |
Quickcheck 4.3.8 / Zikula 3.1.0 / Symfony 5.4.1 / PHP 8.1.2-1ubuntu2.23